ID: 1017004591 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:150020718-150020740 |
| Sequence | AGGGAGAAGGAAGAGGAGGG TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 6314 | |||
| Summary | {0: 2, 1: 7, 2: 97, 3: 839, 4: 5369} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1017004581_1017004591 | 25 | Left | 1017004581 | 6:150020670-150020692 | CCACAGTGTGGGGAGCAGAAGCA | 0: 1 1: 1 2: 3 3: 29 4: 322 |
||
| Right | 1017004591 | 6:150020718-150020740 | AGGGAGAAGGAAGAGGAGGGTGG | 0: 2 1: 7 2: 97 3: 839 4: 5369 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1017004591 | Original CRISPR | AGGGAGAAGGAAGAGGAGGG TGG | Intronic | ||
| Too many off-targets to display for this crispr | |||||