ID: 1017004591

View in Genome Browser
Species Human (GRCh38)
Location 6:150020718-150020740
Sequence AGGGAGAAGGAAGAGGAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 6314
Summary {0: 2, 1: 7, 2: 97, 3: 839, 4: 5369}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017004581_1017004591 25 Left 1017004581 6:150020670-150020692 CCACAGTGTGGGGAGCAGAAGCA 0: 1
1: 1
2: 3
3: 29
4: 322
Right 1017004591 6:150020718-150020740 AGGGAGAAGGAAGAGGAGGGTGG 0: 2
1: 7
2: 97
3: 839
4: 5369

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017004591 Original CRISPR AGGGAGAAGGAAGAGGAGGG TGG Intronic
Too many off-targets to display for this crispr