ID: 1017006864

View in Genome Browser
Species Human (GRCh38)
Location 6:150033719-150033741
Sequence GTGAGGAAGAAGAGTCAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017006864_1017006868 6 Left 1017006864 6:150033719-150033741 CCCTCCTGACTCTTCTTCCTCAC No data
Right 1017006868 6:150033748-150033770 TGCTTCTGCTCCACTCACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017006864 Original CRISPR GTGAGGAAGAAGAGTCAGGA GGG (reversed) Intergenic
No off target data available for this crispr