ID: 1017011816

View in Genome Browser
Species Human (GRCh38)
Location 6:150068624-150068646
Sequence CTTGACCCCAGCTCGGGTTC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 4, 3: 6, 4: 122}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017011810_1017011816 24 Left 1017011810 6:150068577-150068599 CCTGTCTGCTTAGTGACTATTCT 0: 2
1: 1
2: 0
3: 15
4: 130
Right 1017011816 6:150068624-150068646 CTTGACCCCAGCTCGGGTTCCGG 0: 1
1: 0
2: 4
3: 6
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017011816 Original CRISPR CTTGACCCCAGCTCGGGTTC CGG Intronic
900486413 1:2924828-2924850 CTTGGCCCCAGCTTGGGGCCTGG - Intergenic
903965426 1:27086029-27086051 TGTGACCCCAGCTGGGGCTCAGG + Intergenic
904453567 1:30632505-30632527 CTTGACCCCATCTCTGACTCTGG + Intergenic
905452531 1:38065909-38065931 CTTGAGCCCAGCTTGGGAACTGG - Intergenic
905518125 1:38577416-38577438 CTTGACCCCAGCCTGGGCTGAGG + Intergenic
905538315 1:38741098-38741120 CTTGCCCACAGCTTGGGCTCTGG - Intergenic
906711425 1:47932923-47932945 CATGACCCAAGCTCACGTTCTGG - Intronic
906798593 1:48716816-48716838 CTTGACCCCAGCCCAAGCTCAGG - Intronic
909440549 1:75691168-75691190 CTTGACCCTGGCTGGTGTTCAGG - Intergenic
914490124 1:148146509-148146531 CCAGGCCCCAGCTCGGGCTCAGG - Intronic
916469742 1:165111648-165111670 GTTGATTCCAGCTCAGGTTCTGG - Intergenic
918943454 1:191029792-191029814 CTTGAACTCAGCTCTGGATCAGG + Intergenic
920394593 1:205635015-205635037 CTTGTCCCCACCTGGGGTTGTGG - Intergenic
924795776 1:247291273-247291295 CATCACCCCAGCTCAGGTTAAGG + Intergenic
924813261 1:247421674-247421696 TTTTACCCCAGCTCTGGTTATGG - Intronic
1063382803 10:5596918-5596940 CTTGACCACAGCTCGGGCCCAGG - Intergenic
1067270209 10:44784972-44784994 CTTGACCCAAACTGGGGTCCTGG + Intergenic
1071676343 10:87659603-87659625 CTTGACCCCAGGCCGCGTGCCGG + Intronic
1074636085 10:115319406-115319428 CTTGAACTCAGCTCTGGATCAGG - Intronic
1077301344 11:1848569-1848591 AGTGACCCCAGCTCGCGTGCAGG + Intergenic
1077680059 11:4231498-4231520 CAGGACCCCATCTGGGGTTCAGG + Intergenic
1078643149 11:13114504-13114526 CCTGGCCCCAGCTCTGTTTCAGG + Intergenic
1079005493 11:16788887-16788909 CCTCACTCCAGCTCTGGTTCAGG + Exonic
1084142030 11:67238970-67238992 CTTCATCCCAGCTGGGGATCCGG + Intronic
1086993520 11:93330896-93330918 CTTGAACCGAGCGCGGGTCCTGG + Intronic
1088701045 11:112412050-112412072 CTTGACCCCAGCCAGTGTCCAGG - Intergenic
1088890151 11:114037818-114037840 CTTGACTTCAGCTCTGGTCCAGG + Intergenic
1099483408 12:83196599-83196621 CTTGATCTCAGCTTGTGTTCAGG + Intergenic
1104001312 12:124862611-124862633 CTTCACCCCAGCTCTGCATCTGG + Intronic
1104906934 12:132218540-132218562 CTGGAGCCCAGGTCGGTTTCGGG + Intronic
1106157223 13:27170955-27170977 CTTTCCCCCAGCGCGGGGTCGGG + Intronic
1106971706 13:35148114-35148136 CTTGACCCCAGCTGGTGTTCGGG + Intronic
1110502880 13:76249552-76249574 CTTTACCCCAACTCTGTTTCAGG + Intergenic
1113245515 13:108390604-108390626 CTTGCTCCCAGCTGGGCTTCTGG - Intergenic
1115644211 14:35356116-35356138 CCTGCCCCCAGCCCTGGTTCTGG - Intergenic
1122263937 14:100538126-100538148 CTGGAACCCTGCTCGGGCTCAGG + Exonic
1122265212 14:100543521-100543543 CATGACCCCACCTTGGGATCAGG + Intronic
1122543463 14:102510005-102510027 TTCGCCCGCAGCTCGGGTTCCGG - Intergenic
1124704713 15:31954215-31954237 CTTGCCCCCAGCTGGGGTTTGGG - Intergenic
1128327403 15:66734003-66734025 CAGGACCCCAGCTCGGGCACAGG - Intronic
1129078579 15:73019639-73019661 CTCGACCCCAGCCAGGGTCCAGG + Intergenic
1129160579 15:73745418-73745440 CCTGACCTCAGCTGGGGATCAGG - Intronic
1129369196 15:75077730-75077752 CTTGGCCCCAGTTCTGATTCTGG + Intronic
1129375022 15:75124472-75124494 CTTGGCCCCAGTTCTGATTCTGG - Intergenic
1130356273 15:83133668-83133690 CCTGACCCCAGCACAGGCTCAGG + Exonic
1130547745 15:84869014-84869036 CTTGAGCCCAGATGGGGCTCAGG + Exonic
1133754372 16:8751517-8751539 CCTGACCCCACTTCGGGCTCTGG + Intronic
1136268147 16:29132636-29132658 CTTGGCCCCACCCCGGGATCCGG - Intergenic
1137863009 16:51865694-51865716 CTTGACCCCACCCCGAGCTCGGG - Intergenic
1138023136 16:53502815-53502837 CTTAACCAGAGCTCGGGGTCGGG + Intronic
1141583550 16:85017714-85017736 CTGGACACCAGCTGGGGTTGAGG - Intergenic
1143535175 17:7534283-7534305 CTTGACCCCAGCCAGTGTCCAGG - Intergenic
1145404983 17:22581311-22581333 CTTAACCTCAGCTAGGGTTTAGG - Intergenic
1146313418 17:31788584-31788606 CTCCACCCCAGCTCAGGTCCAGG + Intergenic
1150559611 17:66283133-66283155 CTCGACCCCAGCTGGTGTCCAGG + Intergenic
1150703149 17:67465504-67465526 ATTGTCCCCAACTTGGGTTCAGG + Intronic
1152093039 17:78257407-78257429 CATGACCCCAGCTTGGCCTCTGG + Intergenic
1155216478 18:23647835-23647857 CTTGACAGCAGCCCGAGTTCTGG + Intronic
1160947224 19:1649244-1649266 CCTGGCCCAAGCTCGGCTTCTGG + Intronic
1161294301 19:3511959-3511981 CTAGGCCCCGGCTCTGGTTCTGG + Intronic
1161580041 19:5075774-5075796 TCTGACCACAGCTCGGGGTCAGG + Intronic
1161730101 19:5954679-5954701 CTCGGTCCCAGCTCGGCTTCTGG + Intronic
1162315936 19:9937846-9937868 CTCGACCCCAGCTGGTGTCCAGG + Intergenic
1163347036 19:16749842-16749864 CTTGCCCCCTGCCCAGGTTCTGG + Exonic
1165039385 19:33058316-33058338 CCTGACCCCTCCTCAGGTTCTGG - Intronic
1165389353 19:35529480-35529502 CCTGGCCCCAGCCCAGGTTCTGG - Intergenic
1166749857 19:45159546-45159568 CTTGTCCCCAGCTCGGGCCAGGG + Intronic
1166915307 19:46191399-46191421 CTTTAGCCCAGCTCAGGTTGAGG - Intergenic
1167705818 19:51080400-51080422 CTTGACCTCAGGTTGGGCTCTGG + Intronic
925386719 2:3467077-3467099 CTTGACCACAGCGAGGGCTCTGG + Intronic
925464064 2:4090318-4090340 CTTTACCCCAGGTCTGGTACAGG - Intergenic
927445526 2:23157692-23157714 CTTAACCTCAGCTTTGGTTCAGG + Intergenic
931495726 2:62804956-62804978 CTTCACCCCAGCCCTGGTCCTGG + Intronic
934653983 2:96107902-96107924 CTTGAGCCCAGGTGGGGTTGGGG + Intergenic
941164795 2:162073711-162073733 CTCTACCCCTGCCCGGGTTCGGG + Intronic
945792204 2:214318859-214318881 CTCTACTTCAGCTCGGGTTCTGG - Intronic
947718164 2:232352121-232352143 CTTCACCCAAGTTTGGGTTCTGG - Intergenic
947724446 2:232388281-232388303 CTTCACCCAAGTTTGGGTTCTGG - Intergenic
1171031854 20:21683844-21683866 CTTGGCCCCACCTCTGTTTCAGG - Intergenic
1175074363 20:56360422-56360444 CTTGTCCCCAGCTCAGGCCCTGG + Intronic
1175949783 20:62577142-62577164 CTAGACCCCGGCTGGGGGTCAGG + Intergenic
1178296404 21:31413891-31413913 CGTAACCCCAGCTCGTGTTGCGG - Intronic
1182681282 22:32081998-32082020 CTCAAACCCAGCTCGGGATCAGG + Intronic
1185197911 22:49483857-49483879 CTTGACCCCAGATGGGATCCAGG + Intronic
953139142 3:40211341-40211363 CAGGACCCCAGCTCGGCTGCTGG - Intronic
953449157 3:42991846-42991868 CTGGACCCCAGCTCAGGGACTGG + Intronic
959992453 3:112644366-112644388 CTTGACCCCAGCCAGTGTCCAGG + Intronic
962694791 3:137937421-137937443 CTTGGCCCCAGTTAGGATTCTGG - Intergenic
967862017 3:194159563-194159585 CTTCACCCCAGACTGGGTTCAGG - Intergenic
968816329 4:2823655-2823677 CTGGCACCCAGCTCTGGTTCTGG + Intronic
971998604 4:33999048-33999070 CTTAACCTCAGCTAGGGTTTAGG + Intergenic
974499963 4:62686451-62686473 CTTGAACTCAGCTCTGGATCAGG + Intergenic
976375839 4:84343761-84343783 CTTGAACTCAGCTCTGGATCAGG + Intergenic
980625300 4:135367330-135367352 CTTTACCACAGGTTGGGTTCAGG - Intergenic
983402891 4:167287782-167287804 CTTGAACTCAGCTCTGGATCAGG - Intergenic
988046508 5:25962597-25962619 CTCGACCCCAGCTGGTGTCCAGG + Intergenic
996502192 5:124229906-124229928 CTTGACCCCGGCTGGTGTCCAGG - Intergenic
1001128659 5:169044847-169044869 GTAGACCCCAGCTCTGTTTCTGG + Intronic
1006446366 6:34081938-34081960 GCTCACCCCAGCTCGGGTTTGGG - Intronic
1008632596 6:53377712-53377734 AATGACCCCAGATCAGGTTCAGG - Intergenic
1010670814 6:78683665-78683687 CTTGACCACAGCTGGTGTCCAGG - Intergenic
1016990048 6:149922575-149922597 CCTGACCCCAGCTCGGATTCTGG + Intronic
1016992998 6:149942487-149942509 CCTGTCCCCAGCTCCGGTTCCGG - Intronic
1016996576 6:149965548-149965570 CCTGACCCCAGCTAGGGTTCGGG - Intronic
1017002222 6:150004692-150004714 CCTGACCCCAGCTAGGGTTTCGG + Intergenic
1017005337 6:150025034-150025056 CCTGACCCCAGCTCTGTTCCCGG + Intronic
1017011816 6:150068624-150068646 CTTGACCCCAGCTCGGGTTCCGG + Intronic
1018429643 6:163713209-163713231 CCTGACCCCAGCTCTGGCTCAGG + Intergenic
1019429515 7:992243-992265 CTTGGCCCCAGATCTGCTTCTGG + Intergenic
1021793246 7:24227483-24227505 CTTATCTCCAGCTTGGGTTCTGG + Intergenic
1027442118 7:78230726-78230748 CCTGACGCCAGCTCAGATTCTGG + Intronic
1029104031 7:98159748-98159770 CTAGACCCAAGCTCTGGCTCTGG - Intronic
1031189341 7:118526987-118527009 CTTGAGCTCAGCTCTGGATCAGG + Intergenic
1034425384 7:151011198-151011220 TTTGATCCCAGCTCTGGCTCTGG - Intronic
1035224731 7:157426888-157426910 CTGTGCCCCAGCTCGGCTTCTGG - Intergenic
1036685199 8:10904824-10904846 GTTGAGCCCAGCTCTGGCTCAGG - Intronic
1039467565 8:37795520-37795542 CCTGTCCCCAGCCCTGGTTCCGG + Intronic
1040613941 8:49016017-49016039 CTTGAACTCAGCTCTGGATCAGG - Intergenic
1043358595 8:79442492-79442514 CTTGACCCCACCTGGTATTCTGG + Intergenic
1044300791 8:90580780-90580802 CTTGACCCCGGCTGGTGTCCAGG - Intergenic
1049386151 8:142344070-142344092 CATGGCCCCAGCCCTGGTTCCGG - Exonic
1050997088 9:12234076-12234098 CTTGACCCCAGCTGGTATTCAGG + Intergenic
1056092648 9:83219417-83219439 CTTGACCCCTGCCCGGGTTCTGG + Intergenic
1057188870 9:93075000-93075022 CTGTACCCCAGCCCGGGTACAGG + Intronic
1060231313 9:121827448-121827470 CTCGACCCCAGCTCTGGGACTGG + Intronic
1185598919 X:1325619-1325641 TTTGACCCAAGGTCGGGGTCAGG - Intergenic
1188263523 X:28043048-28043070 CTTCCCACCAGCTAGGGTTCCGG - Intergenic
1192873030 X:75203419-75203441 CTTGAACTCAGCTCTGGATCAGG + Intergenic
1193271033 X:79530612-79530634 CTTGCCGCCAGCTAGAGTTCCGG + Intergenic
1196617674 X:117786076-117786098 CTTCATCCCAGCTCTGGTGCAGG + Intergenic
1198450895 X:136766830-136766852 GTTGACTCCTGCTCTGGTTCTGG + Intronic
1200708753 Y:6465274-6465296 CTTGACCTCAGCTCCCCTTCAGG + Intergenic
1201025359 Y:9699435-9699457 CTTGACCTCAGCTCCCCTTCAGG - Intergenic