ID: 1017014163

View in Genome Browser
Species Human (GRCh38)
Location 6:150086402-150086424
Sequence CAGGGTCACCCAGCAATAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017014163_1017014168 1 Left 1017014163 6:150086402-150086424 CCCACTATTGCTGGGTGACCCTG No data
Right 1017014168 6:150086426-150086448 AACAGCCAGTTGACTGTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017014163 Original CRISPR CAGGGTCACCCAGCAATAGT GGG (reversed) Intergenic
No off target data available for this crispr