ID: 1017015335 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:150095169-150095191 |
| Sequence | AAGCCCATGGTAGGATTCAT AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1017015335_1017015339 | 27 | Left | 1017015335 | 6:150095169-150095191 | CCTATGAATCCTACCATGGGCTT | No data | ||
| Right | 1017015339 | 6:150095219-150095241 | ACAGAGTCTTGACATATCCCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1017015335 | Original CRISPR | AAGCCCATGGTAGGATTCAT AGG (reversed) | Intergenic | ||