ID: 1017015336

View in Genome Browser
Species Human (GRCh38)
Location 6:150095178-150095200
Sequence AGCACGTGGAAGCCCATGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017015336_1017015339 18 Left 1017015336 6:150095178-150095200 CCTACCATGGGCTTCCACGTGCT No data
Right 1017015339 6:150095219-150095241 ACAGAGTCTTGACATATCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017015336 Original CRISPR AGCACGTGGAAGCCCATGGT AGG (reversed) Intergenic