ID: 1017015337

View in Genome Browser
Species Human (GRCh38)
Location 6:150095182-150095204
Sequence CACAAGCACGTGGAAGCCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 147}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017015337_1017015339 14 Left 1017015337 6:150095182-150095204 CCATGGGCTTCCACGTGCTTGTG 0: 1
1: 0
2: 2
3: 32
4: 147
Right 1017015339 6:150095219-150095241 ACAGAGTCTTGACATATCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017015337 Original CRISPR CACAAGCACGTGGAAGCCCA TGG (reversed) Intergenic