ID: 1017015338

View in Genome Browser
Species Human (GRCh38)
Location 6:150095192-150095214
Sequence TTGCATAGTTCACAAGCACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017015338_1017015343 26 Left 1017015338 6:150095192-150095214 CCACGTGCTTGTGAACTATGCAA No data
Right 1017015343 6:150095241-150095263 GTAAAATCACATCTCCTCCTGGG No data
1017015338_1017015339 4 Left 1017015338 6:150095192-150095214 CCACGTGCTTGTGAACTATGCAA No data
Right 1017015339 6:150095219-150095241 ACAGAGTCTTGACATATCCCTGG No data
1017015338_1017015342 25 Left 1017015338 6:150095192-150095214 CCACGTGCTTGTGAACTATGCAA No data
Right 1017015342 6:150095240-150095262 GGTAAAATCACATCTCCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017015338 Original CRISPR TTGCATAGTTCACAAGCACG TGG (reversed) Intergenic