ID: 1017015339

View in Genome Browser
Species Human (GRCh38)
Location 6:150095219-150095241
Sequence ACAGAGTCTTGACATATCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017015335_1017015339 27 Left 1017015335 6:150095169-150095191 CCTATGAATCCTACCATGGGCTT No data
Right 1017015339 6:150095219-150095241 ACAGAGTCTTGACATATCCCTGG No data
1017015338_1017015339 4 Left 1017015338 6:150095192-150095214 CCACGTGCTTGTGAACTATGCAA No data
Right 1017015339 6:150095219-150095241 ACAGAGTCTTGACATATCCCTGG No data
1017015336_1017015339 18 Left 1017015336 6:150095178-150095200 CCTACCATGGGCTTCCACGTGCT No data
Right 1017015339 6:150095219-150095241 ACAGAGTCTTGACATATCCCTGG No data
1017015337_1017015339 14 Left 1017015337 6:150095182-150095204 CCATGGGCTTCCACGTGCTTGTG 0: 1
1: 0
2: 2
3: 32
4: 147
Right 1017015339 6:150095219-150095241 ACAGAGTCTTGACATATCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017015339 Original CRISPR ACAGAGTCTTGACATATCCC TGG Intergenic