ID: 1017017540

View in Genome Browser
Species Human (GRCh38)
Location 6:150113884-150113906
Sequence TAGTGGGGAGGACGGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017017540_1017017545 -9 Left 1017017540 6:150113884-150113906 CCTTCCACCCGTCCTCCCCACTA No data
Right 1017017545 6:150113898-150113920 TCCCCACTACCTTTACCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017017540 Original CRISPR TAGTGGGGAGGACGGGTGGA AGG (reversed) Intergenic
No off target data available for this crispr