ID: 1017020521

View in Genome Browser
Species Human (GRCh38)
Location 6:150136427-150136449
Sequence AGGTTTCTACAGATGAATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017020517_1017020521 16 Left 1017020517 6:150136388-150136410 CCTAAAGGCCTCTCTCTTAGTAC No data
Right 1017020521 6:150136427-150136449 AGGTTTCTACAGATGAATTTTGG No data
1017020518_1017020521 8 Left 1017020518 6:150136396-150136418 CCTCTCTCTTAGTACGATCACAT No data
Right 1017020521 6:150136427-150136449 AGGTTTCTACAGATGAATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017020521 Original CRISPR AGGTTTCTACAGATGAATTT TGG Intergenic
No off target data available for this crispr