ID: 1017020521 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 6:150136427-150136449 |
Sequence | AGGTTTCTACAGATGAATTT TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1017020517_1017020521 | 16 | Left | 1017020517 | 6:150136388-150136410 | CCTAAAGGCCTCTCTCTTAGTAC | No data | ||
Right | 1017020521 | 6:150136427-150136449 | AGGTTTCTACAGATGAATTTTGG | No data | ||||
1017020518_1017020521 | 8 | Left | 1017020518 | 6:150136396-150136418 | CCTCTCTCTTAGTACGATCACAT | No data | ||
Right | 1017020521 | 6:150136427-150136449 | AGGTTTCTACAGATGAATTTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1017020521 | Original CRISPR | AGGTTTCTACAGATGAATTT TGG | Intergenic | ||
No off target data available for this crispr |