ID: 1017021527

View in Genome Browser
Species Human (GRCh38)
Location 6:150143580-150143602
Sequence AGTCAGGGACATGCGCGCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 65}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017021527_1017021538 9 Left 1017021527 6:150143580-150143602 CCGGGGCGCGCATGTCCCTGACT 0: 1
1: 0
2: 0
3: 5
4: 65
Right 1017021538 6:150143612-150143634 CAAGTGCCAGGAGCGAGGCGCGG 0: 1
1: 0
2: 2
3: 19
4: 241
1017021527_1017021533 -3 Left 1017021527 6:150143580-150143602 CCGGGGCGCGCATGTCCCTGACT 0: 1
1: 0
2: 0
3: 5
4: 65
Right 1017021533 6:150143600-150143622 ACTCCCGGGGACCAAGTGCCAGG 0: 1
1: 0
2: 0
3: 12
4: 107
1017021527_1017021540 28 Left 1017021527 6:150143580-150143602 CCGGGGCGCGCATGTCCCTGACT 0: 1
1: 0
2: 0
3: 5
4: 65
Right 1017021540 6:150143631-150143653 GCGGCGCCTTCTCTCCCCCGCGG 0: 1
1: 0
2: 1
3: 8
4: 121
1017021527_1017021536 4 Left 1017021527 6:150143580-150143602 CCGGGGCGCGCATGTCCCTGACT 0: 1
1: 0
2: 0
3: 5
4: 65
Right 1017021536 6:150143607-150143629 GGGACCAAGTGCCAGGAGCGAGG 0: 1
1: 0
2: 3
3: 20
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017021527 Original CRISPR AGTCAGGGACATGCGCGCCC CGG (reversed) Intronic
900762169 1:4480599-4480621 AGTCAGGAGCAAGCGTGCCCTGG + Intergenic
900801108 1:4737553-4737575 AGTCTGGGACCTGGGCACCCTGG - Intronic
900851330 1:5145313-5145335 AGTGTGGGACATACGCGCCATGG - Intergenic
902240084 1:15082577-15082599 GGTCAGGGACATGCGGGACCAGG + Intronic
902286751 1:15412094-15412116 AGCCAAGGACGTGGGCGCCCTGG - Intronic
903332124 1:22601621-22601643 TCACAGGGACGTGCGCGCCCTGG + Exonic
916494929 1:165338177-165338199 AGTCAGGAATATGAGCTCCCTGG + Intronic
917437227 1:175033756-175033778 AGTCAGGCCCATGTGCCCCCTGG - Intergenic
918081418 1:181210504-181210526 AGAAAGGGACATGGGCACCCAGG - Intergenic
919642603 1:200060057-200060079 AGCCAGTGGCATGGGCGCCCTGG + Intronic
1063016544 10:2083748-2083770 ACCCAGGCACCTGCGCGCCCAGG - Intergenic
1069744950 10:70709103-70709125 AGTCAGGGTCAGGCGTGGCCTGG + Intronic
1069912837 10:71770445-71770467 AGCCAGGGACATGCATGCCAGGG - Intronic
1070063438 10:73009289-73009311 AGTCAGGGACATGCAAGTGCAGG - Intronic
1074526707 10:114269205-114269227 TTTCAGGGACATGAGAGCCCAGG - Intronic
1077434494 11:2532271-2532293 AGGGAGGGACATGCACGGCCAGG - Intronic
1084154662 11:67306936-67306958 TGTCAGGGAAATCCACGCCCAGG - Exonic
1084963904 11:72733430-72733452 AGTCAGGGGCATGAGACCCCAGG + Intronic
1092423872 12:8357404-8357426 AGTCATGGACTTGTGGGCCCTGG + Intergenic
1094473349 12:30823214-30823236 AGCCTGGGAGATGCGCGTCCAGG - Intergenic
1109637758 13:65145269-65145291 AGTCAAGAACATGCGCACCTGGG + Intergenic
1112326719 13:98446568-98446590 AGACAGGGACTTGGGAGCCCAGG - Intronic
1112415507 13:99200733-99200755 AGTCAGGGGCGTGCGCCCGCTGG - Intergenic
1122381961 14:101314088-101314110 AGCCACGGACAGGCGCACCCAGG - Intergenic
1127647281 15:60971408-60971430 AGTTAGGGACATGCGGGCCTGGG - Intronic
1132971447 16:2691261-2691283 GGTCAGGGACATCCGCACCAGGG - Intronic
1143015925 17:3891136-3891158 AGCCAGGGACATGGACGCCTGGG + Intronic
1143608902 17:8006482-8006504 AGCCAGGGACCTGCGCATCCCGG - Exonic
1145045740 17:19614192-19614214 AGTCAGGGAGATGCGCCACAGGG - Intergenic
1146004184 17:29150425-29150447 AGCCAGGGACCTGCTGGCCCTGG + Intronic
1150440863 17:65190228-65190250 AATCAGGGACATACCCTCCCAGG - Exonic
1152100792 17:78300777-78300799 AGCCAGGGGCAGGCGTGCCCCGG + Intergenic
1153000360 18:449795-449817 AGCCAGGTACATGGGTGCCCGGG - Intronic
1161194354 19:2977893-2977915 AGTCAGGGACGGGGGAGCCCAGG - Intronic
1163128858 19:15259451-15259473 AGCCAGGGCCATGAGCACCCAGG - Intronic
1165227940 19:34367254-34367276 AGTCAGGAACAGGGGCCCCCAGG - Intronic
1165788640 19:38477649-38477671 AGTCAGGGACTCGGGCTCCCTGG - Intronic
1166249280 19:41556025-41556047 AGTCAGGGACAGGCTCCTCCAGG - Intronic
927216579 2:20670912-20670934 ATTCCGGGAGATCCGCGCCCAGG + Exonic
937337814 2:121072521-121072543 ATTCAGGGAAATGGGAGCCCAGG - Intergenic
1175862109 20:62156132-62156154 AGTCAGTGGCTTGCGCCCCCCGG + Intronic
1183650014 22:39148464-39148486 AGGCAGGGGTGTGCGCGCCCAGG + Intronic
1184019561 22:41811564-41811586 AATTAGAGACATGCGCCCCCAGG + Intronic
1185372194 22:50466096-50466118 AGTCAGGGACCTGCAGGCCTGGG + Intronic
950265115 3:11567917-11567939 AATCTGGGACATGAGCCCCCAGG - Intronic
951343246 3:21514716-21514738 ATTCAGGCACATGAGAGCCCTGG + Intronic
961361504 3:126370933-126370955 TGTCAGGGAAAAGCGCCCCCAGG - Intergenic
961431914 3:126889616-126889638 AGCCAGGAACATGGGGGCCCAGG - Intronic
964678049 3:159305293-159305315 AGTCAGGGACATGGGAGACTGGG - Intronic
968977145 4:3827891-3827913 AGTCAGGGGCCTGGGCTCCCTGG - Intergenic
969671907 4:8594304-8594326 AGACAGGGACATGGCAGCCCGGG - Intronic
969865557 4:10074980-10075002 AGGCAGGAACATGAGCCCCCCGG + Exonic
984880282 4:184404786-184404808 AGTCAGGGACAGCCTGGCCCAGG - Intronic
998436056 5:142109290-142109312 ACTCAGGGACCCGCCCGCCCTGG - Intronic
1003272951 6:4623532-4623554 AGTCAGGCTCATGCCCTCCCAGG + Intergenic
1003583987 6:7369301-7369323 ATTAAGGGACATGCACGGCCAGG - Intronic
1004479330 6:16003863-16003885 AGTGAGGAACATGCGTGCACAGG - Intergenic
1017021527 6:150143580-150143602 AGTCAGGGACATGCGCGCCCCGG - Intronic
1024082228 7:45865045-45865067 AGTCAGGGACAGGGGCACACAGG + Intergenic
1030102713 7:105960634-105960656 AGTCAGGGACAGGAGAGCCAAGG + Intronic
1031558341 7:123206349-123206371 AGTCAGAGAGATGAGTGCCCAGG - Intergenic
1031698692 7:124895391-124895413 AGTCAGGAAAATGTGAGCCCTGG + Intronic
1035623166 8:1050565-1050587 ATTCAGGGACAGGCGCTCCTTGG - Intergenic
1036142996 8:6225506-6225528 AGTCAGGAACAGGTGCCCCCAGG - Intergenic
1052861818 9:33442232-33442254 AGTCAGGGACATGGGGGGCAGGG + Intronic
1053293542 9:36897778-36897800 CATCAGGGACATGAGCGCCCTGG - Intronic
1053311807 9:37025310-37025332 AGACACGGACATGCTCGCCCCGG + Intronic
1059320289 9:113463652-113463674 AATCAGGGCCGGGCGCGCCCTGG + Intronic
1062527951 9:136985806-136985828 GGCCAGGTACATGGGCGCCCTGG + Intronic
1203444518 Un_GL000219v1:42574-42596 AGGCAGGGCCATGCGCGCCTCGG - Intergenic
1200159977 X:154001897-154001919 AGTCAGGGACATCTGTGTCCAGG + Intergenic