ID: 1017021601

View in Genome Browser
Species Human (GRCh38)
Location 6:150143845-150143867
Sequence CTCCAGCTGCGCCTCAGCAG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 4, 3: 21, 4: 256}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017021592_1017021601 26 Left 1017021592 6:150143796-150143818 CCTCTGGGCTCCAGCTGCAGCTG 0: 1
1: 1
2: 24
3: 102
4: 647
Right 1017021601 6:150143845-150143867 CTCCAGCTGCGCCTCAGCAGCGG 0: 1
1: 0
2: 4
3: 21
4: 256
1017021593_1017021601 16 Left 1017021593 6:150143806-150143828 CCAGCTGCAGCTGCGCAAAGCGG 0: 1
1: 0
2: 1
3: 13
4: 216
Right 1017021601 6:150143845-150143867 CTCCAGCTGCGCCTCAGCAGCGG 0: 1
1: 0
2: 4
3: 21
4: 256

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017021601 Original CRISPR CTCCAGCTGCGCCTCAGCAG CGG Intronic
900480680 1:2897578-2897600 CCCCAGGTCCCCCTCAGCAGGGG + Intergenic
903178773 1:21595172-21595194 CACCAGGTGGGCCTGAGCAGGGG - Intergenic
903744643 1:25578351-25578373 CACCAGCTGCATATCAGCAGTGG - Intergenic
904467836 1:30718630-30718652 CTCCGTCTGCGCCTCAGCCTCGG + Intronic
905648199 1:39639435-39639457 CTCCAGCACCGCCTGGGCAGAGG - Intronic
906206668 1:43990948-43990970 CTGGGGCTGCTCCTCAGCAGGGG - Exonic
908908878 1:69049165-69049187 CTCCATGTGTGCCTGAGCAGAGG + Intergenic
911309497 1:96275773-96275795 CTTCAGCAGTGCCTTAGCAGAGG - Intergenic
912507686 1:110167288-110167310 CTCCAGTTCTGCCTCAGCAAAGG - Intronic
912738716 1:112173936-112173958 CTCCAGCTGTGCCACAGCAGGGG + Intergenic
913533090 1:119747049-119747071 CACCAGCTGGGCATCAGCACTGG - Intergenic
913983850 1:143547472-143547494 CTCCTGCTGAGCCTCAGCCAAGG - Intergenic
914580225 1:149012723-149012745 CTCCTGCTGAGCCTCAGCCAAGG - Exonic
914946495 1:152071439-152071461 ATCCCTCTGAGCCTCAGCAGTGG + Intergenic
915635653 1:157184731-157184753 CCCCAGCTTGGCCTCAGCTGGGG + Intergenic
915785509 1:158607124-158607146 CTTCTTCTGCCCCTCAGCAGAGG - Exonic
915849485 1:159306006-159306028 CTCCATCACCACCTCAGCAGAGG - Exonic
916272527 1:162958534-162958556 CTCCAGCTGCTCTTCACCTGCGG + Intergenic
917202641 1:172533361-172533383 CTCCATCTTGGCCTCGGCAGTGG + Exonic
919856488 1:201709663-201709685 CTCCCTCTGTGCCCCAGCAGTGG - Intronic
919883169 1:201914308-201914330 CTCAAGCTGGTCCTCAGCATTGG - Intronic
922351685 1:224739240-224739262 CTCAGGCTGCCCCTCAGGAGAGG - Intronic
924254676 1:242170318-242170340 CTCCAGCAGACCCACAGCAGAGG + Intronic
1062996389 10:1870703-1870725 CTCCAGGTGGCCCTGAGCAGTGG + Intergenic
1063459126 10:6204164-6204186 CTCGAGCTCCACCTCAGCTGCGG + Intronic
1064086879 10:12351627-12351649 GTGCAGCTGCACCTCTGCAGTGG + Intronic
1066306636 10:34150655-34150677 CTCCAGCTGGGCCTCAGGCTTGG + Intronic
1066974145 10:42349473-42349495 CTCCAGCTGGGCCTCTACTGTGG + Intergenic
1068266115 10:54652278-54652300 CTCCAGCTGAGTCTCAGGATTGG - Intronic
1068955180 10:62814999-62815021 CTCCCGCTGCGCTTCAGCCGAGG + Intronic
1070832899 10:79431172-79431194 GTCCAGCTGAGCCCCAGCACAGG - Intronic
1073774294 10:106768764-106768786 TTCCAGCTGCACCACACCAGGGG + Intronic
1074869761 10:117567413-117567435 GTCCAGCTGGGGCTCAGCTGGGG - Intergenic
1076797013 10:132803285-132803307 CTCCAGCTGCAGCTCCACAGGGG + Intergenic
1077168276 11:1153412-1153434 CTCCTGCTGCCTCCCAGCAGGGG - Intergenic
1077168422 11:1153948-1153970 CCCCAGCTGGACCCCAGCAGCGG + Intergenic
1077919807 11:6633590-6633612 CTCCAGCTGCACCACAGAATTGG + Exonic
1078130803 11:8612678-8612700 CTCCAGCTGAGCCCCAGCAAGGG + Exonic
1078938070 11:15969979-15970001 CTCCAGCTCTGCCTCAGTACTGG - Exonic
1084501534 11:69538388-69538410 CTCCAGCTGAGCCACCACAGAGG + Intergenic
1084557360 11:69883054-69883076 CTCCAGCTGCTCCTTCGCTGTGG + Intergenic
1085015019 11:73168369-73168391 CTCCAGCTGGGCCTCTCCATTGG - Intergenic
1085043743 11:73341901-73341923 CTGCAGCTGTGCCTCAGCCCTGG - Intronic
1085464548 11:76715027-76715049 CTGCTGCTGCTCCTCAGCTGTGG + Intergenic
1086821854 11:91445464-91445486 CTCCATCTGTGCCTGAGCAGTGG - Intergenic
1089299334 11:117489202-117489224 CTGCAGCTGCCCCGCCGCAGAGG - Intronic
1090830222 11:130416070-130416092 CTCCAGCTGTGCCTCCTCACAGG - Intronic
1093978767 12:25452575-25452597 CTCCATGTGGGCTTCAGCAGTGG - Intronic
1095584483 12:43835750-43835772 CTGCAGCTGCCGCTCTGCAGAGG + Intergenic
1096550957 12:52371215-52371237 CAAGAGCTGCGTCTCAGCAGCGG - Intergenic
1096590056 12:52652058-52652080 CTTCAGCAGCGGCTCAGCTGTGG - Exonic
1098008977 12:66030473-66030495 CTCCAGATGTGCCACAGCTGAGG + Intergenic
1100768634 12:97897562-97897584 CTCCAGCAGACCTTCAGCAGAGG - Intergenic
1103063336 12:117876295-117876317 CTCCAGCCCTCCCTCAGCAGGGG - Intronic
1105229765 13:18481254-18481276 CTCCAGCTGGGCCTCTACTGTGG + Intergenic
1107087749 13:36444262-36444284 CTCCAGAGGCCCCTCTGCAGAGG - Intergenic
1108357104 13:49637959-49637981 CTCCAGCTGGGCAGCAACAGGGG + Intergenic
1110422269 13:75326209-75326231 CTGGAGCTCTGCCTCAGCAGAGG + Exonic
1110799849 13:79682288-79682310 CTCCAACTTGGCCTCAGCTGGGG + Intergenic
1111413006 13:87901382-87901404 TTCCAGCTGGGCCTCTGCAACGG + Intergenic
1112164523 13:96904048-96904070 CTCCAGCTGGTCCTCACCAATGG - Intergenic
1114014009 14:18408090-18408112 CTCCAGCTGTGCCTCTACTGTGG + Intergenic
1114293771 14:21311072-21311094 ACCCAGCTGTGCCTCACCAGAGG + Intronic
1114626958 14:24136329-24136351 CTCCAGCCACGCCTCCCCAGTGG - Intronic
1120037619 14:79715886-79715908 CTACAGCAGGGCCTCAGCATAGG - Intronic
1120185078 14:81385942-81385964 CTCAAGCATCGCCTCTGCAGCGG - Intronic
1122177428 14:99931399-99931421 GCCCAACAGCGCCTCAGCAGAGG - Intronic
1123205302 14:106706925-106706947 CTCCAGATGCACTTAAGCAGTGG + Intergenic
1123815569 15:23975196-23975218 CCCCAGCTGAGCCTCAGCCTGGG + Intergenic
1123821917 15:24038882-24038904 CTCCAACTGAGCCTCAGCATGGG - Intergenic
1125525040 15:40369286-40369308 GACCAGCTGCGCCACAGCCGTGG + Exonic
1126443631 15:48718426-48718448 CTCCAGTGGAGCCTCAGTAGGGG - Intronic
1126851824 15:52801748-52801770 CTGGAGCTGCCCCACAGCAGGGG - Intergenic
1126952100 15:53893110-53893132 CTCCAGCAGATCTTCAGCAGAGG - Intergenic
1127353854 15:58179379-58179401 GTCATGCTGCGCCTCACCAGTGG + Intronic
1129742285 15:77995107-77995129 CTCCAGTTGCCCAGCAGCAGTGG + Exonic
1129884277 15:79027686-79027708 CACCAGGTGGGCCCCAGCAGCGG - Intronic
1130567432 15:85008619-85008641 CTCCAGCTTCCCCACAGCTGAGG + Intronic
1130906388 15:88243436-88243458 CTCCAGCCTCCTCTCAGCAGAGG - Intronic
1132345665 15:101107261-101107283 CTCCCGCAGCGCCTCTGGAGGGG - Intergenic
1132480047 16:162865-162887 CTCCAGCTGTGACTCAGGGGTGG + Intronic
1133100416 16:3475965-3475987 CTTCAGCTGGGGCTGAGCAGTGG + Intronic
1133249986 16:4474487-4474509 CTCCATCCCCGCCTCTGCAGTGG - Exonic
1138143218 16:54586260-54586282 CTCCAGCTGCCCGTCTGAAGGGG + Intergenic
1139613541 16:68075511-68075533 CTCCAGCTTGGCCTCAGCTTGGG + Intronic
1140946225 16:79770655-79770677 CTCCAGCCGCGGCCCAGAAGAGG + Intergenic
1141774851 16:86116441-86116463 CTCCAGCTGGGCCCAAGGAGGGG - Intergenic
1141935845 16:87237209-87237231 CTCCAGCTGCACCCGGGCAGGGG + Intronic
1142245422 16:88968120-88968142 CTCCAGGTGGGCCCCAGCATGGG - Intronic
1144711827 17:17406266-17406288 GTGCAGCTGAGCCCCAGCAGAGG + Intergenic
1145282354 17:21477262-21477284 CTTCTGCTGTTCCTCAGCAGAGG + Intergenic
1145982176 17:29019483-29019505 CTCCAGCTTCCCCTCCCCAGAGG + Intronic
1146059613 17:29597626-29597648 CTCCAGCTTCTCCTCAGCAGAGG - Intronic
1147968565 17:44207268-44207290 CTCCAGCTCCTCCTCCTCAGGGG - Exonic
1148134731 17:45284876-45284898 CACCAGCTCCGCCTGGGCAGAGG - Exonic
1148785694 17:50145159-50145181 CTCCAGCTCGTACTCAGCAGAGG + Exonic
1150001512 17:61443555-61443577 CTGCAGCTGCAGCTCAACAGGGG + Intergenic
1150782570 17:68134939-68134961 GTCCAGCTGCGCCTCTGCCAAGG + Intergenic
1151586807 17:75013795-75013817 CCCCAGGTGTGGCTCAGCAGGGG + Intronic
1152623334 17:81377117-81377139 TGCCAGGTGGGCCTCAGCAGCGG + Intergenic
1152652193 17:81499832-81499854 CCCCAGCTGTGGCTCAGCAGTGG - Intergenic
1153926653 18:9840482-9840504 CTCCAGCTGCACTTCAGGAGAGG - Intronic
1154453777 18:14502654-14502676 CTCCAGGTGCACCTTTGCAGAGG + Intergenic
1154523636 18:15258586-15258608 CTCCAGCTGGGCCTCTACTGTGG - Intergenic
1156166646 18:34429244-34429266 CTCCAGCAGACCTTCAGCAGAGG - Intergenic
1158587713 18:58755982-58756004 CTCCTGCCTCTCCTCAGCAGGGG - Intergenic
1158962304 18:62596888-62596910 CTCCAGCGGCGCCCGGGCAGAGG - Intergenic
1160838693 19:1136727-1136749 CTGCAGATGCGTTTCAGCAGGGG - Intronic
1161170664 19:2810922-2810944 CTGCAGCTGCATCTCAGCTGGGG - Intronic
1162113286 19:8413092-8413114 CTCCGGCTCCGCCCCAGCACTGG - Intronic
1162474439 19:10891538-10891560 CTCCAGCTGGGTCACAGAAGAGG + Intronic
1162964799 19:14150742-14150764 CTCCAGGTGCCCCTCAGCCATGG - Exonic
1165013472 19:32864760-32864782 ACCCAGCTGGGCCTCATCAGTGG - Exonic
1165420904 19:35721407-35721429 CTCCAGCTGAGCCTGAGCCTCGG + Exonic
1166317968 19:41999151-41999173 CGCGAGATGCGCCTCAGCAACGG - Exonic
1166695529 19:44849363-44849385 CTCCAGCTGTGGGACAGCAGAGG + Intronic
1167418812 19:49390855-49390877 CAGCAGCTGCGCCGCGGCAGGGG + Exonic
1167573003 19:50301836-50301858 CTCTAGCTGCTCCTCAGCCTGGG - Exonic
1167771723 19:51525016-51525038 CTCCACATGGGCCTGAGCAGTGG - Intronic
1167840234 19:52110848-52110870 CTCCAGCTCCACCTCAGCCTTGG + Intergenic
927087781 2:19688398-19688420 ATCCAGCTGGGCCTCAGGATAGG + Intergenic
927464200 2:23324810-23324832 CTCCAGCTGGGCCTTACCATGGG - Intergenic
932628211 2:73315820-73315842 CTCCAGATGAGCCTCTCCAGAGG - Intergenic
933446733 2:82389762-82389784 CTGCCTCTGCACCTCAGCAGAGG - Intergenic
935438152 2:103059395-103059417 CTCCAGCAGAGCTGCAGCAGAGG - Intergenic
937224921 2:120363242-120363264 CTCCAGCTCTGCCTCAGGTGAGG - Intergenic
937326728 2:120993886-120993908 CTCCAACTGTGGCTCAGCTGGGG + Intergenic
937871799 2:126791590-126791612 CTCCACCTGCACCACAGCTGAGG + Intergenic
938522943 2:132091442-132091464 CTCCAGCTGGGCCTCTACTGTGG - Intergenic
938716652 2:134027798-134027820 CTGCAGCTGCACCCCTGCAGGGG + Intergenic
939895627 2:147787740-147787762 CTCCAGCTGTCTCTCAGAAGTGG - Intergenic
940962087 2:159797716-159797738 CTCCGGCCGCGCACCAGCAGGGG + Intronic
940984211 2:160036647-160036669 CTCCATCCCAGCCTCAGCAGAGG - Intronic
941516455 2:166486232-166486254 TGCCAGCTTCTCCTCAGCAGTGG + Intronic
942829824 2:180226324-180226346 CTCAGGCTGAGACTCAGCAGTGG + Intergenic
945706058 2:213233292-213233314 CTACAGCTCCGTCTCAGCAAAGG - Intergenic
947364777 2:229382148-229382170 CTCCAGCAGACCCACAGCAGAGG + Intronic
947633116 2:231666364-231666386 CTCCTGCTGCGCCGCCTCAGGGG - Intergenic
948289756 2:236816381-236816403 CTCCTGCTGGGCCTCCACAGAGG - Intergenic
948427323 2:237896107-237896129 CTGCATCTGGGCCTGAGCAGGGG - Intronic
948889072 2:240898040-240898062 CTCCACCTGTGCCCCAGCTGAGG + Intergenic
1168813790 20:723030-723052 CTCCAGCAGGGCAACAGCAGGGG + Intergenic
1169217505 20:3802066-3802088 CTCCTGCTGCTCCTCAGGAGGGG - Exonic
1170229286 20:14027668-14027690 CTCCAGCTGACCTGCAGCAGTGG - Intronic
1171249436 20:23637346-23637368 CTCGAGCTGCGCCGCAGCGCGGG - Intronic
1171375005 20:24686387-24686409 CTACAGCTGGGGCTCAGGAGCGG + Intergenic
1176020320 20:62959301-62959323 CTCCAGCTGCGCTTCCTCTGCGG + Intronic
1176231344 20:64034560-64034582 CTGCAGCTGCTCCTCAGGACGGG - Intronic
1176307201 21:5129964-5129986 CTGGAGCTGCGGCTCTGCAGTGG - Intergenic
1176773756 21:13109613-13109635 CTCCAGCTGGGCCTCTACTGTGG + Intergenic
1179067574 21:38040379-38040401 CCCCAGCTGGGCCTCAGATGAGG + Intronic
1179849858 21:44132066-44132088 CTGGAGCTGCGGCTCTGCAGTGG + Intergenic
1180438508 22:15338896-15338918 CTCCAGCTGTGCCTCTACTGTGG + Intergenic
1180521365 22:16209325-16209347 CTCCAGCTGGGCCTCTACTGTGG + Intergenic
1182444381 22:30381530-30381552 CTCCAGGTGCGCCTCTGCACAGG + Intronic
1182575713 22:31271617-31271639 CTCCCACTGCCCCTCAGCTGTGG + Intronic
1183618721 22:38960368-38960390 CTCCATCACCGCCTAAGCAGTGG + Intronic
1183623923 22:38990313-38990335 CTCCATCACCGCCTAAGCAGTGG + Intronic
1184877280 22:47283768-47283790 CTCCAAATGCTCCTGAGCAGCGG + Intergenic
1184924490 22:47627337-47627359 CTGGAGCTGTGCCTCAGCTGGGG - Intergenic
949546891 3:5080238-5080260 CTCCAGCTCCTCCTCTTCAGGGG - Intergenic
950471030 3:13186610-13186632 CTCCAGATGGGCCTCTGCATAGG - Intergenic
952377844 3:32781737-32781759 CTCCAGCTGACCCTCAGCTGTGG + Intergenic
952511134 3:34057319-34057341 CTCCACCTGCACCACAGCTGAGG - Intergenic
952902304 3:38118311-38118333 CTCCACCAGCATCTCAGCAGTGG - Intronic
952947651 3:38490224-38490246 CTTCAGCTGGGCCTCAGGACTGG - Exonic
954713638 3:52516716-52516738 CTCCACCTGCGCCTGTGCTGCGG + Exonic
956207579 3:66770750-66770772 CTCCAGCAGACCTTCAGCAGAGG - Intergenic
957474936 3:80710316-80710338 CTCCAGCAGAGCTGCAGCAGAGG + Intergenic
960947284 3:122975299-122975321 GTCCAGCTGCGCCTCAGCCTTGG + Intronic
960949535 3:122990218-122990240 CCCCACCTCCCCCTCAGCAGAGG - Intronic
961213773 3:125144416-125144438 CTCCAGCTGGGACCCTGCAGAGG + Intronic
961602036 3:128069693-128069715 CTCCAGAAGCGCCTCGGAAGGGG + Exonic
965100313 3:164289626-164289648 CTCCAGCTGCCCCTGTGAAGAGG - Intergenic
966356121 3:179080460-179080482 CTCCATCTCTGCCTCAGCAGAGG + Intergenic
967051804 3:185791882-185791904 CTCCAGCTCTGCCTTAGCAGAGG - Intronic
967341431 3:188403115-188403137 CTCCAGCTGCTCCTCCTGAGAGG - Intronic
968953136 4:3704894-3704916 CACGAGAGGCGCCTCAGCAGAGG - Intergenic
970326986 4:14936225-14936247 CTGCACCTGGGGCTCAGCAGTGG + Intergenic
971480343 4:27109178-27109200 CTCCAGCTGAGAGCCAGCAGAGG + Intergenic
973081758 4:46002540-46002562 CTCCAGCAGACCTTCAGCAGGGG - Intergenic
975121645 4:70735226-70735248 CTCCACCTCCCCCTCAGGAGGGG - Intronic
976534241 4:86193028-86193050 CTCCAGCAGAGCTGCAGCAGAGG - Intronic
977846543 4:101773753-101773775 CTCCATGTGGGCCTGAGCAGTGG + Intronic
979362744 4:119783766-119783788 CTCCAGCTCCAGCTTAGCAGGGG - Intergenic
979732770 4:124045052-124045074 CTCTAGCTGCCCCTTGGCAGAGG + Intergenic
981659192 4:147146263-147146285 CTGCAGCTGCGCCTGAGCTCTGG - Intergenic
984122132 4:175758757-175758779 CCCCTGCTGTGCCTCAGTAGAGG - Intronic
985665343 5:1179236-1179258 CCCCAGCTGAGCCTCACCTGAGG - Intergenic
985727686 5:1524427-1524449 TTCCAGCCGCGCCTCAGCCCAGG + Intergenic
986174961 5:5344174-5344196 CTCCAGCTGCACCTCTGTGGAGG - Intergenic
991046681 5:62230531-62230553 CTCCAGCAGAGCTGCAGCAGAGG - Intergenic
991117360 5:62969956-62969978 CTCCAGCCATGACTCAGCAGAGG + Intergenic
991150350 5:63360629-63360651 CTCCAGCAGATCTTCAGCAGAGG - Intergenic
991515834 5:67434301-67434323 CTGCAGAGGCACCTCAGCAGAGG - Intergenic
993794335 5:92248764-92248786 CTCCATATGTGCCTGAGCAGTGG - Intergenic
995858011 5:116614209-116614231 CTCCTGCTTCTCTTCAGCAGAGG - Intergenic
996101878 5:119452662-119452684 AGCCAGCTGCGCCTCAGCAAGGG - Exonic
996786406 5:127241471-127241493 CTCCAGCTGAGCCTAAACTGGGG + Intergenic
998257163 5:140596768-140596790 CTCCACTTGCGCCGCAGCTGAGG - Intergenic
999449184 5:151665614-151665636 CTCCATCTGAGGCTGAGCAGGGG + Intronic
999838410 5:155399216-155399238 GTCAAGCTTCGCCTCAGCAGAGG - Intergenic
1003507264 6:6750306-6750328 CTCCCCCTGCACCTCTGCAGAGG - Intergenic
1004078123 6:12364044-12364066 CTCCAGCAAGGCCTCAGCTGAGG - Intergenic
1005350750 6:24933034-24933056 CTCCAGCTATACCACAGCAGGGG + Intronic
1006113969 6:31765629-31765651 CTCCAACTGTGCCCCACCAGGGG + Exonic
1009324826 6:62337666-62337688 CTCCATGTGGGCCTGAGCAGTGG - Intergenic
1013471644 6:110471886-110471908 TTCCAGCTGTGCCTCAGCAGGGG - Intronic
1013595975 6:111661645-111661667 AGCCAGCTGCTCCCCAGCAGCGG - Exonic
1015585909 6:134776148-134776170 CTCCAGCAGATCTTCAGCAGAGG + Intergenic
1017021601 6:150143845-150143867 CTCCAGCTGCGCCTCAGCAGCGG + Intronic
1017498591 6:155003568-155003590 TCCCAGCTGTGCCTCAGCTGTGG + Intronic
1017818446 6:158031602-158031624 CTCACGCTGCGCCACAACAGTGG - Intronic
1018900855 6:168051048-168051070 CGCCAGCTGCCCCTCAGCAGGGG + Intergenic
1019422578 7:957953-957975 CTCCAGCGTCGCCTGAGCACGGG + Intronic
1019770385 7:2880644-2880666 CTCCAGCTGGGCCTCTGCCCAGG + Intergenic
1021116777 7:16753747-16753769 CTCCTGCTCCGGCTCAGCTGCGG + Exonic
1022795942 7:33731442-33731464 CTCCAGGTGCGCCTTGGCTGGGG + Intergenic
1023118563 7:36886238-36886260 TTCAAGCTGAGCCTCAGGAGAGG - Intronic
1023790620 7:43750309-43750331 CTCCCTCTGCGACTCAGAAGGGG + Intergenic
1024590032 7:50872979-50873001 CTCTGGCTGCCCCTTAGCAGAGG - Intergenic
1024998412 7:55294176-55294198 CTCCAGCAGACCTTCAGCAGAGG - Intergenic
1029679181 7:102096223-102096245 CACCAGCTGTGCCTCTGCAGGGG + Intronic
1031442820 7:121814122-121814144 CTCCACATGTGCCTGAGCAGTGG - Intergenic
1032192998 7:129775092-129775114 CCCCAGCAGGCCCTCAGCAGCGG + Intergenic
1032732803 7:134660567-134660589 CACCAGCTACGTCTTAGCAGGGG - Intronic
1035232165 7:157471699-157471721 CTCCTGTTGCCCCTCAGCAGTGG - Intergenic
1035249070 7:157585218-157585240 CTGCAGCTGCTCCTCAGCCCTGG - Intronic
1035699127 8:1624740-1624762 CTCCCGCTGCACCTGGGCAGTGG - Intronic
1035757364 8:2044205-2044227 CTCCAGCTGCACCTCACCACAGG - Intergenic
1036163183 8:6407190-6407212 CTCCAGGTGGGCCTCAGAGGGGG - Intronic
1037990786 8:23320036-23320058 CTGCAGCTGCGCCTGAACGGCGG - Exonic
1038067613 8:23979430-23979452 AAGCAGCTGCGTCTCAGCAGGGG + Intergenic
1039918459 8:41876343-41876365 CTCTGGCCGCGACTCAGCAGCGG + Intronic
1041724548 8:61005873-61005895 CTGCAGCTGCACCCCAGCCGAGG + Intergenic
1042195688 8:66229417-66229439 CTCCAGCAGGCCTTCAGCAGAGG + Intergenic
1042752404 8:72172058-72172080 CTCCATCTGTGTCTCAGCAAAGG + Intergenic
1044279484 8:90339210-90339232 CTCCAGCTGAGCCTCAGTATGGG - Intergenic
1044785349 8:95787263-95787285 TTCCAGCTGCTCCTCTGCTGGGG + Intergenic
1047998402 8:130357959-130357981 CTCCAGCTGCGCGGCGGCAGCGG + Intronic
1049310354 8:141930904-141930926 CACCAGCCCCTCCTCAGCAGAGG + Intergenic
1049361468 8:142214213-142214235 CTCCAGCTGCAGCCCTGCAGTGG - Intronic
1049397452 8:142407921-142407943 CTCCTGCAGGGCCTCAGCACAGG - Intergenic
1049529278 8:143146378-143146400 CTCCAGCTGCAGCTCAGCCCTGG - Intergenic
1049643929 8:143727760-143727782 CTCCGGCTCCGCCTCGGGAGCGG + Exonic
1049682137 8:143924094-143924116 CTCCAGCTCCGCCTTGCCAGCGG + Exonic
1049731319 8:144180015-144180037 CCTCAGCAGCCCCTCAGCAGAGG + Intronic
1052293116 9:26866882-26866904 CTCCAGATGCTCTACAGCAGGGG + Intronic
1053449534 9:38181474-38181496 CTCACGCTGCACCTCAGCAGTGG + Intergenic
1053701630 9:40698599-40698621 CTCCAGCTGGGCCTCTACTGTGG - Intergenic
1054411695 9:64822054-64822076 CTCCAGCTGGGCCTCTACTGTGG - Intergenic
1056546312 9:87616774-87616796 CACAAGCTGAGCCTCAGTAGAGG + Intronic
1056791514 9:89628244-89628266 CTCCATCTGTGCCACAGCATGGG - Intergenic
1056922906 9:90807836-90807858 CTCCAACTGCTCCCCAACAGTGG - Intronic
1057186923 9:93062253-93062275 CTCCACCTGCCCCTGAGCCGTGG + Intronic
1057255093 9:93539835-93539857 CTCCAGCTGCCCCTTTGCAGGGG + Intronic
1057386699 9:94611309-94611331 CTGCAGCTGAGCGTAAGCAGGGG + Intronic
1057854764 9:98593833-98593855 CTCCAGCTGAGTCGCTGCAGAGG - Intronic
1059262654 9:112993560-112993582 CTCTAGCTGCCCCTTGGCAGAGG + Intergenic
1060761065 9:126249258-126249280 CTCCACCTCCACCTCAGCCGAGG + Intergenic
1061941601 9:133887025-133887047 CTCCTGCTCTCCCTCAGCAGTGG + Intronic
1062017147 9:134296685-134296707 CTCCAGCTGCACCTCGGGGGAGG - Intergenic
1203770743 EBV:48833-48855 CTCCAACTGCGGCTCTGCGGCGG + Intergenic
1193575763 X:83193818-83193840 ATGCAGCTGCTCATCAGCAGGGG + Intergenic
1195241974 X:102960810-102960832 CTCCATGTGTGCCTGAGCAGTGG + Intergenic
1196951051 X:120875673-120875695 CACCAGCAGCGCCTCAACTGGGG + Exonic
1196951882 X:120932045-120932067 CACCAGCAGCGCCTCAACTGGGG + Exonic
1196952566 X:120936906-120936928 CACCAGCAGCGCCTCAACTGGGG + Exonic
1196953251 X:120941767-120941789 CACCAGCAGCGCCTCAACTGGGG + Exonic
1196953936 X:120946627-120946649 CACCAGCAGCGCCTCAACTGGGG + Exonic
1196954621 X:120951488-120951510 CACCAGCAGCGCCTCAACTGGGG + Exonic
1196955304 X:120956348-120956370 CACCAGCAGCGCCTCAACTGGGG + Exonic
1196955991 X:120961231-120961253 CACCAGCAGCGCCTCAACTGGGG + Exonic
1196956673 X:120966092-120966114 CACCAGCAGCGCCTCAACTGGGG + Exonic
1196957355 X:120970952-120970974 CACCAGCAGCGCCTCAACTGGGG + Exonic
1196958037 X:120975812-120975834 CACCAGCAGCGCCTCAACTGGGG + Exonic
1196958719 X:120980672-120980694 CACCAGCAGCGCCTCAACTGGGG + Exonic
1196959400 X:120985532-120985554 CACCAGCAGCGCCTCAACTGGGG + Exonic
1198068927 X:133128657-133128679 CTCCAGCTGCCCTGGAGCAGTGG - Intergenic
1199988889 X:152972763-152972785 GTCCAGCTGAACCTGAGCAGAGG - Exonic
1202176876 Y:22106209-22106231 CTCCAGCAGGACCTGAGCAGAGG - Intergenic
1202214485 Y:22480175-22480197 CTCCAGCAGGACCTGAGCAGAGG + Intergenic