ID: 1017024150

View in Genome Browser
Species Human (GRCh38)
Location 6:150166902-150166924
Sequence TTCACTCGGTTCCAAATGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 195}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017024150_1017024157 13 Left 1017024150 6:150166902-150166924 CCAGTCATTTGGAACCGAGTGAA 0: 1
1: 0
2: 0
3: 11
4: 195
Right 1017024157 6:150166938-150166960 AAGCAGAAAGAGGCCAGGCGCGG No data
1017024150_1017024158 16 Left 1017024150 6:150166902-150166924 CCAGTCATTTGGAACCGAGTGAA 0: 1
1: 0
2: 0
3: 11
4: 195
Right 1017024158 6:150166941-150166963 CAGAAAGAGGCCAGGCGCGGTGG 0: 3
1: 29
2: 486
3: 2971
4: 13292
1017024150_1017024154 3 Left 1017024150 6:150166902-150166924 CCAGTCATTTGGAACCGAGTGAA 0: 1
1: 0
2: 0
3: 11
4: 195
Right 1017024154 6:150166928-150166950 ACCTAAAGGAAAGCAGAAAGAGG No data
1017024150_1017024156 8 Left 1017024150 6:150166902-150166924 CCAGTCATTTGGAACCGAGTGAA 0: 1
1: 0
2: 0
3: 11
4: 195
Right 1017024156 6:150166933-150166955 AAGGAAAGCAGAAAGAGGCCAGG 0: 1
1: 0
2: 18
3: 160
4: 1633

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017024150 Original CRISPR TTCACTCGGTTCCAAATGAC TGG (reversed) Intronic
906083517 1:43109508-43109530 TTGACTCAGTTCCACATGGCTGG - Intergenic
906406448 1:45546244-45546266 GTCACTCAGTTCCACATGGCTGG + Intergenic
906498315 1:46321329-46321351 TTAACTCAGTTCCACATGGCTGG - Intergenic
906874601 1:49523500-49523522 TTCACTTGATTCCAAAAAACTGG + Intronic
907611092 1:55871959-55871981 TTGACTCAGTTCCACATGGCTGG + Intergenic
908458632 1:64328079-64328101 ATCACTCGGGTCCAAATCCCAGG - Intergenic
910090146 1:83452324-83452346 ATCCCTTGGTTCCACATGACAGG - Intergenic
910120750 1:83787087-83787109 TTCACATGGATTCAAATGACTGG + Intergenic
911630484 1:100178224-100178246 TTCACTTGGTTACAGCTGACTGG - Exonic
912592703 1:110842411-110842433 TTCATTTTGTTGCAAATGACAGG + Intergenic
918167478 1:181964388-181964410 TTGACTCAGTTCCATATGGCTGG + Intergenic
921295649 1:213699367-213699389 TCCATTTTGTTCCAAATGACAGG + Intergenic
922625603 1:227038293-227038315 TTGACTCAGTTCCACATGACTGG - Intronic
923433142 1:233943007-233943029 TTCATGCTGTTGCAAATGACAGG + Intronic
924024940 1:239822034-239822056 TTGACTCAGTTCCACATGGCTGG - Intronic
924838700 1:247683800-247683822 TCCATTCTGTTGCAAATGACAGG + Intergenic
1069178315 10:65323205-65323227 TACACTCAGTTCCACATGTCTGG - Intergenic
1069335231 10:67341500-67341522 TCCATGTGGTTCCAAATGACAGG + Intronic
1072251073 10:93582795-93582817 TTGACTCGGTTCCACATGGCTGG + Intronic
1074410913 10:113227710-113227732 TACAATAGGTTCCAAATGAGTGG - Intergenic
1079443099 11:20534883-20534905 TTGACTCAGTTCCACATGGCTGG + Intergenic
1079885288 11:25980978-25981000 TTGACTCAGTTCCACATGGCTGG + Intergenic
1085303254 11:75471137-75471159 TTCACCAAGTTCCAAATGAGGGG + Intronic
1089038482 11:115422161-115422183 TTAACTGGGTTACAAATTACAGG + Intronic
1092398773 12:8153641-8153663 TTCACCCAGTTCCAAATTCCTGG + Intronic
1099130124 12:78817997-78818019 TTCATACTGCTCCAAATGACAGG + Intergenic
1099524479 12:83702824-83702846 TTCATGCTGTTGCAAATGACAGG - Intergenic
1099782099 12:87209188-87209210 ATCATTCTGTTGCAAATGACAGG - Intergenic
1104338555 12:127925353-127925375 TTGACTCAGTTCCACATGGCTGG + Intergenic
1104862735 12:131932912-131932934 TTGACTCAGTTCCACATGGCTGG + Intronic
1105912229 13:24880146-24880168 TTGACTCAGTTCCACATGGCTGG + Intergenic
1106040014 13:26081105-26081127 TTCATTCAGTTAGAAATGACAGG - Intergenic
1106570981 13:30927531-30927553 TTGACTCAGTTCCACATGGCTGG - Intergenic
1107294996 13:38899109-38899131 TTCACTCACTTCCAAAAGGCTGG - Intergenic
1107396899 13:40027285-40027307 ATCACTCAGCCCCAAATGACTGG - Intergenic
1107436781 13:40387535-40387557 TTGACTCAGTTCCATATGACTGG + Intergenic
1108958819 13:56195921-56195943 TCCACGTTGTTCCAAATGACAGG + Intergenic
1111936655 13:94564737-94564759 TTCTCTTGGCTCCAAACGACAGG - Intergenic
1112499786 13:99933925-99933947 TTGACTCAGTTCGACATGACTGG + Intergenic
1119764059 14:77177310-77177332 TTGACTCAGTTCCACATGGCTGG + Intronic
1120389650 14:83889247-83889269 TTGACTCAGTTCCACATGGCTGG - Intergenic
1120391274 14:83911252-83911274 TTGACTCAGTTCCACATGGCTGG - Intergenic
1120593125 14:86399814-86399836 TCCACGTTGTTCCAAATGACAGG - Intergenic
1120610667 14:86637227-86637249 TTGACTCAGTTCCACATGGCTGG - Intergenic
1122080079 14:99261041-99261063 TTCACCCGATTCCAAAGAACGGG + Intronic
1124038880 15:26082203-26082225 TTCACTGTGTTCCAAAAGAAAGG + Intergenic
1127615632 15:60682757-60682779 TTGATTCACTTCCAAATGACTGG + Intronic
1129645871 15:77431936-77431958 TTCATTTTGTTGCAAATGACAGG + Intronic
1130694473 15:86116781-86116803 TTCTCTAGGTTGCAGATGACAGG + Intergenic
1131123544 15:89838674-89838696 TTAACTAAGTGCCAAATGACTGG + Intronic
1131298542 15:91173680-91173702 CCCAGTCTGTTCCAAATGACTGG + Intronic
1133480518 16:6166284-6166306 CTCTCTGGGGTCCAAATGACGGG + Intronic
1133735809 16:8614804-8614826 TTGACTCAGTTCCACATGGCTGG - Intergenic
1135879941 16:26245400-26245422 TTCACATTGTTGCAAATGACAGG - Intergenic
1137697947 16:50474957-50474979 TGGACTCAGTTCCACATGACTGG - Intergenic
1139058728 16:63222151-63222173 TTGACTCAGTTCCACATGGCTGG + Intergenic
1140610411 16:76592107-76592129 TTCACCTGGTTCCAAAAGCCTGG - Intronic
1141000520 16:80303115-80303137 TTGACTCAGTTCCAAATGTCTGG - Intergenic
1141175326 16:81714617-81714639 TTCACACTGCTCCCAATGACAGG - Intergenic
1141764344 16:86048627-86048649 TTCCCACGGTGCCAAAAGACAGG - Intergenic
1144289303 17:13810026-13810048 TTGACTCAGTTCCACATGGCCGG - Intergenic
1145358536 17:22187633-22187655 TTCACGTTGTTGCAAATGACAGG + Intergenic
1149331361 17:55586121-55586143 TTGACTCAGTTCCACATGGCTGG + Intergenic
1150915847 17:69435994-69436016 TTAAATCGATTCCAAATGATTGG - Intronic
1151851472 17:76692892-76692914 TTCACCAGGTTCCAAAGAACTGG + Intronic
1155270995 18:24140849-24140871 TCCACTTTGTTGCAAATGACAGG + Intronic
1156187280 18:34677956-34677978 TTGACTCAGTTCCAGATGGCTGG + Intronic
1158228162 18:55222012-55222034 TTCACTTGGTTTCAGATGAATGG + Intergenic
1158261765 18:55613568-55613590 TTGACTCAGTTCCACATGGCTGG + Intronic
1158516301 18:58133077-58133099 TTTACTCAGTTCCACATGCCAGG - Intronic
1159137035 18:64348630-64348652 TTGACTCAGTTCCACATGGCTGG + Intergenic
1159202873 18:65209915-65209937 TTCATTCTGTTGCAAATGACAGG + Intergenic
1164724180 19:30454064-30454086 CTCACTTGCTTCCAAAGGACAGG + Intronic
1165820262 19:38670387-38670409 CTCACAAGGGTCCAAATGACAGG - Intronic
1168001948 19:53453844-53453866 TTCACTCTGTTGCAACTGGCTGG - Intronic
1168053873 19:53850030-53850052 TCCATGCTGTTCCAAATGACAGG - Intergenic
925033244 2:667997-668019 TTGACTCAGTTCCACATGGCCGG + Exonic
927887767 2:26728981-26729003 TTCCCTTGGTTCCAAAAGCCAGG + Exonic
929587002 2:43122551-43122573 TTCACTAGGCTCCAACTGAAAGG + Intergenic
934124748 2:88877349-88877371 TTGACTCAGTTCCATATGGCTGG + Intergenic
934892269 2:98080996-98081018 TTCACACAGTTCCACATGCCTGG + Intergenic
934905316 2:98195949-98195971 TTTATTTGGTTGCAAATGACAGG - Intronic
939582969 2:143973200-143973222 TAAACTCGATTCCAGATGACAGG + Intronic
942395613 2:175545325-175545347 TCCATGCTGTTCCAAATGACTGG - Intergenic
943323208 2:186471667-186471689 TTGACTCAGTTCCACATGGCTGG + Intergenic
944368196 2:198949255-198949277 TTGACTCAGTTCCACATGGCTGG - Intergenic
944751106 2:202710860-202710882 TTCATGCTGTTGCAAATGACAGG + Intronic
947093580 2:226541433-226541455 TTGACTCAGTTCCACATGGCTGG + Intergenic
948955475 2:241287003-241287025 TTCACCCTGTATCAAATGACTGG + Intronic
1173501691 20:43558620-43558642 TTCACTAGGTTCCAAGCGAAAGG + Intronic
1173542966 20:43868443-43868465 TTGACTCAGTTCCAAATGGCTGG - Intergenic
1175562621 20:59944126-59944148 TCCACTCGGTTCCAGGTGTCAGG + Exonic
1177261130 21:18731974-18731996 TTCATGCTGTTGCAAATGACAGG + Intergenic
1177688035 21:24465575-24465597 TTGACTCAGTTCCATATGGCTGG - Intergenic
1178114676 21:29405056-29405078 TCCAAACTGTTCCAAATGACAGG - Intronic
1178211804 21:30543135-30543157 TCCATTCTGTTGCAAATGACAGG + Intronic
1178576051 21:33792735-33792757 TTCCCTCTGTTCCACATGTCAGG + Intronic
1178585757 21:33869219-33869241 TTGACTCAGTTCCACATGGCTGG + Intronic
1179338324 21:40479485-40479507 TTGACTCAGTTCCACATGGCTGG + Intronic
1180076996 21:45468040-45468062 TTCACTCATTCCCAAACGACAGG - Intronic
1181579642 22:23820914-23820936 GCCACGTGGTTCCAAATGACTGG + Intronic
952584809 3:34878109-34878131 TTGACTCAGTTCCACATGGCTGG - Intergenic
954366300 3:50147959-50147981 CTTACTTAGTTCCAAATGACTGG - Intergenic
955516313 3:59729781-59729803 TTCATTTGGTTCAAAAAGACGGG - Intergenic
955580818 3:60419500-60419522 TTCACTCTGTTACAAATCAAGGG + Intronic
956932159 3:74056084-74056106 TTCATTCAGTTGTAAATGACTGG + Intergenic
957374191 3:79335601-79335623 TTGACTCAGTTCCACATGGCTGG - Intronic
958175719 3:89993641-89993663 TTCATGTTGTTCCAAATGACAGG - Intergenic
959807815 3:110578502-110578524 TTCAATTAATTCCAAATGACTGG - Intergenic
960668752 3:120136446-120136468 TTCATGCTGTTGCAAATGACTGG - Intergenic
961920680 3:130422553-130422575 ATGACTTAGTTCCAAATGACAGG + Intronic
962570243 3:136705733-136705755 TTGACTCAATTCCAAATGGCTGG - Intronic
963134492 3:141888876-141888898 TTGACTCAGTTCCACATGGCTGG - Intronic
963898016 3:150706567-150706589 TTGACTCAGTTCCATATAACTGG + Intergenic
966968760 3:185022249-185022271 TTGACTCAGTTCCACATGGCTGG - Intronic
967453494 3:189652932-189652954 TTGACTCAGTTCCACATGGCTGG - Intronic
968265962 3:197363643-197363665 TTCACTGGGTTCCTTTTGACGGG - Intergenic
969917174 4:10502205-10502227 TTGACTCAGTTCCACATGGCTGG + Intronic
970805987 4:20032734-20032756 TTGACTCAGTTCCACATGGCTGG - Intergenic
970989102 4:22192000-22192022 TTTTCTCGGTTCCAAAATACTGG - Intergenic
973136631 4:46716302-46716324 TTGACTCAGTTCCACATGGCTGG + Intergenic
973989623 4:56390966-56390988 TTGACTCGGTTCCACATGGCTGG + Intergenic
974717018 4:65680020-65680042 TTCTCACAGTTCCACATGACTGG - Intergenic
976287402 4:83384094-83384116 TTGACTCAGTTCCACATGGCTGG + Intergenic
977236332 4:94511780-94511802 TTCATGTGGTTGCAAATGACAGG + Intronic
977429956 4:96919732-96919754 TTGACTCAGTTCCACATGGCTGG + Intergenic
977471519 4:97448639-97448661 TTGACTCAGTTTCACATGACTGG - Intronic
977772632 4:100878081-100878103 TTGACTCAGTTCCACATGGCTGG + Intronic
978369778 4:108018564-108018586 TTCCCTCCTTTCCAAATAACTGG + Intronic
978558305 4:110004692-110004714 TTCACTGAGTTCAGAATGACTGG + Intronic
978803896 4:112780650-112780672 TTGACTCAGTTCCAAATGGCTGG + Intergenic
980066133 4:128190711-128190733 TTGACTCAGTTCCACATGGCTGG - Intronic
980391596 4:132154980-132155002 TTGACTCAGTTCCACATGACTGG + Intergenic
983130726 4:164016177-164016199 TTGACTCAGTTCCATATGGCTGG + Intronic
984816677 4:183844334-183844356 TTCACTCAGCTACAAATGTCAGG - Intergenic
986197271 5:5549592-5549614 TTTTCTCAGTTCCAAATGAGAGG - Intergenic
986913199 5:12583509-12583531 TCCACACTGTTGCAAATGACAGG + Intergenic
988876749 5:35455594-35455616 TTGACTCAGTTCCACATGCCTGG + Intergenic
990524536 5:56611866-56611888 TTCACATTGTTGCAAATGACTGG - Intergenic
992320507 5:75608932-75608954 TTCACTCTGTTTCAAATATCAGG - Intergenic
992660867 5:78959277-78959299 TTGACTCAGTTCCACATGGCTGG - Intronic
993076395 5:83237396-83237418 TTCATGCTGTTGCAAATGACAGG - Intronic
993743163 5:91564374-91564396 TTAACTCAGTTCCACATGGCTGG + Intergenic
994136250 5:96290582-96290604 TTCACTGGTTTCCCAAAGACAGG - Intergenic
995517893 5:112972401-112972423 TTGACTCAGTTCCACATGGCTGG - Intergenic
995620061 5:114015466-114015488 TTGACTCAGTTCCACATGGCTGG - Intergenic
996683958 5:126259013-126259035 TTGACTCAGTTCCATATGGCTGG - Intergenic
999191905 5:149754557-149754579 TTTACTTGGTTTCAAATGAGTGG + Intronic
999405594 5:151303980-151304002 TGCACTCCCTTCCAAATCACTGG - Intergenic
1003291710 6:4784985-4785007 TTAACTCAGTTCCACATGGCTGG - Intronic
1004455610 6:15788809-15788831 TTGACTCAGTTCCACATGGCTGG - Intergenic
1004905036 6:20229689-20229711 TTCTTTCAGTTGCAAATGACAGG + Intergenic
1008400880 6:51061262-51061284 TTGACTCAATTCCAAATGGCAGG + Intergenic
1009983097 6:70749084-70749106 TTGACTCGGTTCCTCATGGCTGG + Intronic
1010909019 6:81530167-81530189 TTCCCTCTGTGCTAAATGACTGG - Intronic
1012349294 6:98231762-98231784 TTGACTCTGTTCCACATGGCTGG + Intergenic
1013741369 6:113290166-113290188 TTTACTCAGTTCCATATGGCTGG - Intergenic
1014275271 6:119380960-119380982 TGCATGCTGTTCCAAATGACAGG + Intergenic
1014639506 6:123892340-123892362 TTGACTCAGTTCCACATGTCTGG + Intronic
1014825693 6:126046697-126046719 TCCACTCGGTTTCAACTGATAGG + Intergenic
1017024150 6:150166902-150166924 TTCACTCGGTTCCAAATGACTGG - Intronic
1021281653 7:18727309-18727331 TTCAATCAGTTCAAACTGACAGG + Intronic
1024432593 7:49306760-49306782 TCCACACTGTTACAAATGACAGG + Intergenic
1026531556 7:71202921-71202943 TTCACGTTGTTGCAAATGACAGG + Intronic
1027306995 7:76908770-76908792 ATCCCTTGGTTCCACATGACAGG - Intergenic
1027578542 7:79962118-79962140 TTAACTAGGTTCCAGATGCCAGG - Intergenic
1031787737 7:126056141-126056163 TTCATGCTGTTGCAAATGACTGG - Intergenic
1033042903 7:137934543-137934565 TTCAGCCAGTTCCAAATCACAGG + Intronic
1033716927 7:144011702-144011724 TTGACTCAGTTCCACATGCCTGG - Intergenic
1034572932 7:151971911-151971933 TTGACTCAGTTCCACATGGCTGG - Intronic
1035093464 7:156333241-156333263 TTCACTGGGATGTAAATGACAGG + Intergenic
1035549319 8:508392-508414 TTGACTCAGTTCCACATGGCTGG + Intronic
1036013821 8:4758614-4758636 TTGACTCAGTTCCACATGGCTGG + Intronic
1036806294 8:11836581-11836603 TCCACTCGTTTCCAAATAAATGG + Intronic
1037621717 8:20569310-20569332 TTCACCCTGTCGCAAATGACAGG + Intergenic
1038386139 8:27147651-27147673 TTGACTCAGTTCCACATGGCTGG - Intergenic
1039732611 8:40295788-40295810 TTGACTCAGTTCCACATGGCTGG - Intergenic
1041401782 8:57453466-57453488 TTCACGCTGTCACAAATGACAGG + Intergenic
1043271586 8:78340515-78340537 ACCACTCTTTTCCAAATGACAGG + Intergenic
1044494529 8:92861156-92861178 TTCACTCTGTGCCAAGTGCCAGG - Intergenic
1045942789 8:107757531-107757553 TTGACTCAGTTCCACATGCCCGG - Intergenic
1045993552 8:108338270-108338292 TTGACTCAGTTCCACATGGCTGG + Intronic
1048873131 8:138815143-138815165 TTGACTCAGTTCCAAATGGCTGG - Intronic
1050993387 9:12181700-12181722 TTGACTCAGTTCCACATGGCTGG + Intergenic
1052760442 9:32584982-32585004 TTCATGCTGTTGCAAATGACAGG + Intergenic
1053155754 9:35777705-35777727 ATCTTTTGGTTCCAAATGACTGG + Intergenic
1055172449 9:73275574-73275596 TTCATTCTGTTGCAAATGACAGG + Intergenic
1055446047 9:76383269-76383291 TTGACTCAGTTCCACATGGCTGG + Intergenic
1056697184 9:88869524-88869546 TCCACTTTGTTGCAAATGACAGG - Intergenic
1059863966 9:118493118-118493140 TTCATGTGGTTGCAAATGACAGG + Intergenic
1060155962 9:121319903-121319925 TTGACTCCGTTCCTAATGATAGG + Intronic
1062301094 9:135870383-135870405 TTGACTCAGTTCCACATGGCTGG - Intronic
1185947616 X:4395424-4395446 TTCACACAGTTCCACATGGCTGG + Intergenic
1186761793 X:12730777-12730799 TTCATTTTGTTGCAAATGACAGG - Intergenic
1187623250 X:21082450-21082472 TTAACTCAGTTCCACATGGCTGG + Intergenic
1188399059 X:29721941-29721963 TTCAGTTGTTTCAAAATGACAGG + Intronic
1190480091 X:50868700-50868722 TTCATTTTGTTGCAAATGACAGG + Intergenic
1191140769 X:57114564-57114586 TTGACTCAGTTCCACATGGCTGG + Intergenic
1192708524 X:73555038-73555060 TTGACTCAGTTCCACATGGCTGG + Intergenic
1193664992 X:84305303-84305325 TTCACGTTGTTGCAAATGACTGG - Intergenic
1196247770 X:113420903-113420925 TTCATGCTGTTGCAAATGACAGG - Intergenic
1196345945 X:114658996-114659018 TTGACTCAGTTCCACATGGCTGG + Intronic
1198563655 X:137880771-137880793 TGGACTCAGTTCCAAGTGACCGG - Intergenic
1198696747 X:139348828-139348850 TTCATGTGGTTGCAAATGACAGG + Intergenic
1199075768 X:143523721-143523743 TCCACGTGGTTGCAAATGACGGG + Intergenic
1199349684 X:146786431-146786453 TTGACTCAGTTTCACATGACCGG - Intergenic
1199361087 X:146919743-146919765 TTCATGTGGTTGCAAATGACTGG + Intergenic