ID: 1017026284

View in Genome Browser
Species Human (GRCh38)
Location 6:150184244-150184266
Sequence TTTAAGGCACAAATGGAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 194}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017026281_1017026284 -4 Left 1017026281 6:150184225-150184247 CCAATCATGTCTTTGTGCTTTTA 0: 1
1: 0
2: 3
3: 36
4: 385
Right 1017026284 6:150184244-150184266 TTTAAGGCACAAATGGAGCATGG 0: 1
1: 0
2: 0
3: 20
4: 194
1017026280_1017026284 3 Left 1017026280 6:150184218-150184240 CCTGTGACCAATCATGTCTTTGT 0: 1
1: 0
2: 1
3: 12
4: 163
Right 1017026284 6:150184244-150184266 TTTAAGGCACAAATGGAGCATGG 0: 1
1: 0
2: 0
3: 20
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017026284 Original CRISPR TTTAAGGCACAAATGGAGCA TGG Intronic
905548848 1:38819859-38819881 TGTAAGACACAAATGTATCAAGG + Intergenic
909049420 1:70750679-70750701 TTTAAGGCACCTAGGGAGAATGG - Intergenic
909533227 1:76704438-76704460 TTTAAATCAGAAATTGAGCAAGG - Intergenic
910989369 1:93039127-93039149 TTTGAGTCACAACTGGAGGATGG + Intergenic
911529535 1:99028231-99028253 TTTAAGGGATTAATGGAGGAAGG - Intergenic
915074740 1:153298865-153298887 TCCAAGGCAAACATGGAGCAAGG - Intronic
915245512 1:154553464-154553486 TTTTAGGAACAGTTGGAGCAGGG - Intronic
916742612 1:167659736-167659758 TTTAAGGAGCAAATGGGGGAGGG - Intronic
917029186 1:170670746-170670768 ATTAAGGCACAAATGGTGGTTGG + Intronic
917980532 1:180266348-180266370 ATTAGGGCACACAGGGAGCAAGG - Intronic
918087337 1:181256862-181256884 TTTAAGGGCAAGATGGAGCAAGG + Intergenic
918923874 1:190753476-190753498 TTGAGGGCACAACTGGAACAGGG + Intergenic
920626296 1:207604714-207604736 TTTAAGGCACAAAAACAGAAGGG - Intronic
920767760 1:208849919-208849941 ATAAAGTCACAAATGGAGCTAGG - Intergenic
920825219 1:209418632-209418654 TTTAAGGCAGAATAAGAGCATGG + Intergenic
922037933 1:221867533-221867555 TTTAAGGAACTAATAGAGTATGG - Intergenic
923760325 1:236836689-236836711 TTTAAGACACAAATGAAAGATGG - Intronic
924306635 1:242696386-242696408 TTTATGAAAGAAATGGAGCAAGG - Intergenic
1062941472 10:1424676-1424698 TAAAAGGCACAGATGGGGCATGG + Intronic
1063112828 10:3051806-3051828 CACAACGCACAAATGGAGCAAGG + Intergenic
1063681277 10:8189958-8189980 TCCAAGCCACAAATGGAGAATGG + Intergenic
1065299742 10:24310648-24310670 TTAGAGGCACACCTGGAGCAAGG - Intronic
1067393205 10:45885000-45885022 TTTAAGGCCGAGATGGAGCTTGG - Intergenic
1067861527 10:49854128-49854150 TTTAAGGCCGAGATGGAGCTTGG - Intronic
1068714365 10:60171901-60171923 TTTAATGCACAAATGGTACATGG - Intronic
1070618150 10:77985323-77985345 TCTAGGGCACAGATGGAGCCAGG - Exonic
1071326004 10:84518953-84518975 TTTTAGGAACAAAAGGAGTAAGG + Intergenic
1072639451 10:97200489-97200511 GATAAGGCACAGAAGGAGCACGG - Intronic
1073319448 10:102605683-102605705 TTTAAGGCAGAACTGGAAAAGGG - Intronic
1073801627 10:107047722-107047744 TTCAGGGAACAACTGGAGCAGGG - Intronic
1073807347 10:107111894-107111916 TTTCAGGCCAAAATGGAGTAAGG + Intronic
1075341082 10:121647300-121647322 TGTGAGGAACAAATGGAGCAGGG + Intergenic
1078947435 11:16085447-16085469 TTTAATGCTCAAATGGACAAAGG - Intronic
1079074635 11:17376593-17376615 TGTCAGGCATAAATGGAACATGG + Exonic
1079725071 11:23870397-23870419 CTTATGGCAGAAAAGGAGCAAGG - Intergenic
1080749049 11:35135950-35135972 TTTACTGCACTAATGGAGAAGGG + Intergenic
1082781947 11:57294766-57294788 TTAGAGGAACAAATGGAGCCTGG - Intergenic
1083539256 11:63500847-63500869 TGTAAGGGAAAAATGGAGTAGGG + Intergenic
1083598226 11:63930117-63930139 TGTAGGGCACAAAAGAAGCAAGG - Intergenic
1083788361 11:64967539-64967561 AGTGAGGCACAAATGGAGAATGG + Intronic
1086213404 11:84348593-84348615 TTTATGGCACACATGGTGTATGG + Intronic
1086832517 11:91583261-91583283 TTTAGGGAACAAATTGAGGAGGG + Intergenic
1086937164 11:92757638-92757660 TTCCAGGCACAAATGTGGCAGGG + Intronic
1087222783 11:95564509-95564531 GTTTAGGCACAAATGAAGCTGGG + Intergenic
1087289653 11:96306430-96306452 TTCAAGTCACAAAGGGAGCTAGG - Intronic
1088109947 11:106249652-106249674 TTTAAAGCACAGAAGGACCATGG - Intergenic
1093743489 12:22713831-22713853 TATATGGCTCAAATGGTGCAAGG + Intergenic
1093786092 12:23193584-23193606 TTTCAGGCACATATTGAGCTAGG - Intergenic
1094052168 12:26232330-26232352 TTTAAAGCACAAATGCCCCAAGG + Exonic
1094773796 12:33697603-33697625 TTGAATGCAAAAATGGAGCAAGG - Intergenic
1095200044 12:39373190-39373212 TTTAATGCAAAGATGTAGCATGG - Intronic
1097885369 12:64723685-64723707 TTTAAGACACAAATGGTGAAAGG + Intronic
1099772823 12:87084320-87084342 TTTATGGCATTAATGGAGAATGG - Intergenic
1102894993 12:116591826-116591848 CTTCAGGCACAACTGGATCAAGG - Intergenic
1103104613 12:118212657-118212679 TATAAGGCAAAAAAGGAACAGGG + Intronic
1104395426 12:128428263-128428285 TTTCAGGTACAAATGCATCAGGG + Intronic
1107318953 13:39165655-39165677 TATAAGGAACAAATGGTGCCGGG - Intergenic
1109686384 13:65825924-65825946 TTTAAAGATCAAATGGTGCATGG - Intergenic
1110757156 13:79188955-79188977 TTTGAGGCTCAAATGGAGTTTGG - Intergenic
1112662217 13:101523145-101523167 TTTCAAGGACAAATGGAGCTAGG - Intronic
1112922685 13:104634962-104634984 TTTATGGAACAGATGAAGCAGGG - Intergenic
1117046537 14:51818297-51818319 ATTAAGGAACCAATGAAGCATGG - Intergenic
1118660131 14:67999884-67999906 TTTAAGGAACTAAATGAGCAAGG + Intronic
1119711788 14:76827880-76827902 TGTCAGGCACAAATGGTGCCAGG - Intronic
1121045483 14:90784714-90784736 TTTGAAGCCCAAATGCAGCAGGG + Intronic
1121309776 14:92929424-92929446 AGAAAGGCTCAAATGGAGCAAGG - Intronic
1121330232 14:93045066-93045088 TTTCAGGCTCAAAAGCAGCATGG - Intronic
1123937202 15:25199754-25199776 TGAAAGACACAAGTGGAGCAGGG - Intergenic
1124141291 15:27079383-27079405 TTTAAAGGACAACAGGAGCAGGG + Intronic
1125539647 15:40462568-40462590 TGTAAGGGACAAAGTGAGCAGGG - Intronic
1125771894 15:42173678-42173700 TATAAGGGACTAATGGAGGAGGG - Intronic
1127655537 15:61051898-61051920 TGAAAGGCAGAAATGGAGGAGGG - Intronic
1128602913 15:69012807-69012829 TTGAAAGCAGAACTGGAGCAGGG - Intronic
1129278304 15:74462077-74462099 ATTAAGGCAGCAATTGAGCAGGG + Intergenic
1129710096 15:77816526-77816548 TTTAAAACACAAATATAGCAGGG + Intronic
1130059853 15:80561417-80561439 GTCAAGGCACAAATGGAAGAAGG - Intronic
1131953000 15:97701992-97702014 TTGAAAGCATAAATGGACCAGGG + Intergenic
1135636056 16:24076672-24076694 TTAAAGGCACACTTGTAGCAAGG - Intronic
1138438406 16:57019984-57020006 GTGCAGGCACAAATGGAGTAGGG + Intronic
1139443798 16:66984083-66984105 TTTAAAGCAAAAATTGACCAAGG - Intergenic
1144517440 17:15928435-15928457 TTCCAGGCACACATGGAGCAGGG + Intergenic
1146892192 17:36513456-36513478 GTCAATGCCCAAATGGAGCATGG + Exonic
1148373336 17:47118256-47118278 TTTAAGGTACAACAGCAGCATGG + Intronic
1148428641 17:47623591-47623613 CTTAAGGCACCAGTGAAGCAGGG + Intergenic
1149001240 17:51759819-51759841 CTTAAGGCACGAAGGGAGGATGG - Intronic
1151113791 17:71709850-71709872 TTTAAGGTAACACTGGAGCAAGG - Intergenic
1154141530 18:11828241-11828263 TTTAAGGCACAATAGAAGCTGGG + Intronic
1155598589 18:27516826-27516848 TATAAGGTTCAGATGGAGCAGGG + Intergenic
1158278773 18:55797821-55797843 TTTAAAAAACAGATGGAGCAAGG - Intergenic
1158745004 18:60189534-60189556 TAGAAGTCACAAATGCAGCATGG - Intergenic
1159013789 18:63084555-63084577 TTTAAAACACAAATGCAGGATGG + Intergenic
1163086265 19:14981865-14981887 ATTAAGGAACATGTGGAGCAGGG + Intronic
1167945680 19:52986701-52986723 TTGAATGCAAAGATGGAGCAAGG - Intergenic
925164378 2:1706343-1706365 TTTAAGTCACAAATCGGACACGG + Intronic
925659855 2:6190897-6190919 TTTAAGACACAAGAGGAGCTGGG - Intergenic
925979788 2:9167292-9167314 TTTAAGATTCAAATGGGGCAGGG + Intergenic
926054226 2:9764849-9764871 CTTCAGGAACAAATGAAGCAGGG - Intergenic
926065075 2:9832114-9832136 TTTAAGGCAGAATGGGAGGAGGG - Intergenic
928668834 2:33579661-33579683 GTTAAGGGATAGATGGAGCAGGG - Intergenic
928997353 2:37307114-37307136 TTGGATGCACAACTGGAGCAGGG - Intronic
929830968 2:45345890-45345912 TATGGGGCACAAATGGAGCCTGG - Intergenic
931596036 2:63944717-63944739 TTTAATGTACAAATGGAACATGG - Intronic
931895726 2:66727397-66727419 TTTAAGGCACCAGTGGAACATGG + Intergenic
935041896 2:99439104-99439126 TTTAAGGCACCATTAGAGCTAGG + Exonic
935076697 2:99752510-99752532 TTTAAGGTATAAAGGGAGCATGG - Intronic
935634486 2:105239446-105239468 TTAAAGGAACAAATAGTGCAAGG - Intergenic
935708845 2:105879831-105879853 TTTAAGGAAGAAAAGGAGAAAGG + Intronic
936953157 2:117998523-117998545 TTTAAAGCAAAAATGGAGATTGG - Intronic
937539739 2:122934527-122934549 TTTAAGGCAAATGAGGAGCAAGG + Intergenic
939426453 2:142044201-142044223 TTTAATGCACAAATAAAGCAAGG - Intronic
939429847 2:142089153-142089175 TTGAAGGGACATATGGAGCCAGG + Intronic
939834102 2:147106898-147106920 TTTCAGCAAGAAATGGAGCAAGG + Intergenic
940730346 2:157382521-157382543 TATTAGGCACACATGGTGCATGG - Intergenic
943283367 2:185965440-185965462 TGTCAGGCATAAATGGAACATGG - Intergenic
943678358 2:190740583-190740605 TTTAAGTAACAAATTGAGGATGG - Intergenic
945804611 2:214475225-214475247 TTTTATGCCCAAATGGACCAGGG + Intronic
946092817 2:217246000-217246022 TTCAAGGCACCCAAGGAGCAAGG - Intergenic
947469482 2:230387388-230387410 TTTAAGACCCAAATGGCCCAAGG - Intronic
1169084529 20:2818489-2818511 TCTAAGGCAAAAATGAACCAGGG - Intronic
1170935971 20:20809921-20809943 TCTAAGGCAGAAATGAAGAAAGG - Intergenic
1172382747 20:34510152-34510174 TTAAAGGAAAAAATGGAGTAGGG - Exonic
1176916632 21:14633629-14633651 CTTCATGGACAAATGGAGCAGGG + Intronic
1177189735 21:17837574-17837596 TATAAGGCACAACTGGGCCAGGG + Intergenic
1177700032 21:24626842-24626864 TTTAAAGCACCTATGGATCACGG - Intergenic
1178254025 21:31034239-31034261 TTTAAAACAGAAATGGAGCAAGG + Intergenic
1180854565 22:19037952-19037974 TTTATGGCACAAATGGGGCCGGG + Exonic
1181737496 22:24893241-24893263 CTGAAGACACAAAGGGAGCAAGG - Intronic
952153633 3:30619694-30619716 TGTAGGGCACAAATAGAGAATGG - Intronic
953500149 3:43425344-43425366 TTGAGAGCACAAATGGAGCGGGG + Intronic
955457721 3:59142385-59142407 TTGAAGCCAGAAATGCAGCAAGG - Intergenic
955754942 3:62217162-62217184 TCTAATGAAAAAATGGAGCAGGG + Intronic
958935810 3:100254299-100254321 TTTAAGGGACATAAGGAGCTTGG + Intergenic
958945854 3:100361246-100361268 TTTAAAGCAAGAATGCAGCATGG - Intergenic
959702590 3:109312024-109312046 TTTAAGACACAAAATAAGCATGG - Intronic
960545472 3:118909581-118909603 ATTAAGGCATAGATGGAGAAGGG + Intronic
965384020 3:168024364-168024386 TTTAAAGCAAAAATGGATCATGG - Intronic
967864246 3:194177331-194177353 TGGAAGGCACAGATGGAGGAAGG + Intergenic
967949365 3:194829019-194829041 TTTAAGCCACAAATCCAACAAGG - Intergenic
972225611 4:37007759-37007781 ATTAAGGCACAAATTAAGCGGGG - Intergenic
972262212 4:37420708-37420730 AAAAAGGCACAAAAGGAGCAGGG + Intronic
972591840 4:40495293-40495315 TTTAGGGAACAAATTGAGGAGGG - Intronic
973787755 4:54349369-54349391 TTCAAGGCACAACAGGAGCCAGG + Intergenic
973901862 4:55483432-55483454 TTTAATGCAAATATGGTGCAGGG + Intronic
974433823 4:61832125-61832147 TTTAATGCACATATGGAGTTAGG + Intronic
974543937 4:63275688-63275710 TTTCTGGCACAAGTGCAGCATGG + Intergenic
974808273 4:66911043-66911065 TATAAGCCATAAATGGAGCATGG + Intergenic
975808045 4:78133819-78133841 TTTAAAGCACAAAGGAATCACGG + Intronic
976203676 4:82604217-82604239 TTTAAGGCCTAAAGGGAGCCTGG - Intergenic
978705324 4:111702163-111702185 TTTATGGGAAAAAGGGAGCAAGG + Intergenic
982088051 4:151856160-151856182 ATTAAGGAAGAAAGGGAGCATGG + Intergenic
982475163 4:155841521-155841543 TTCAAGGAAGCAATGGAGCAGGG - Intronic
983267553 4:165523340-165523362 TTGAAGGCACAAATGAAGACAGG - Intergenic
985306611 4:188549086-188549108 TTTAAGGCATTCATGGACCATGG - Intergenic
986506886 5:8461069-8461091 TTTTAGGAAGAAATGAAGCAAGG - Intergenic
987418589 5:17691602-17691624 TTTCAGACAGAAATGCAGCATGG - Intergenic
987964477 5:24853948-24853970 TTGAATGGACAAATGGACCAGGG - Intergenic
991409614 5:66333196-66333218 TTGCAGGCACAAAAGCAGCAAGG - Intergenic
992259744 5:74957771-74957793 TTCAAGGAAAAAATGGAGAAGGG + Intergenic
994251818 5:97544634-97544656 TTAAAGGCAGAAATGGAGAGTGG - Intergenic
997510146 5:134448395-134448417 TTTACGGCGCAGATGGAGAATGG + Intergenic
998371076 5:141661862-141661884 TTTTAGGCACAAATGCAGGATGG + Intronic
998517387 5:142769002-142769024 TTAAATTCATAAATGGAGCATGG - Intergenic
999597889 5:153225493-153225515 TTTAAGGCACACATCAACCAAGG - Intergenic
999771075 5:154775925-154775947 TTAAATGCACAAAAGGGGCACGG + Intronic
1000704062 5:164489504-164489526 TTTATGGCACCAATAGAGAAAGG - Intergenic
1005360382 6:25025525-25025547 TTTAAGGCACAAATAGTGCTGGG - Intronic
1005751466 6:28886727-28886749 TTTAAGGCTCAAGTGGGGCCAGG + Intergenic
1007877200 6:45118527-45118549 TTTTAGGAACAAATGGTGCATGG - Intronic
1007913650 6:45540296-45540318 TTTAAGTCACACAGGCAGCAGGG - Intronic
1007999980 6:46350211-46350233 TTTAATGCATGAATGGAGCAGGG + Intronic
1008960498 6:57261270-57261292 CTTAAGGGACAAAAGGAGCCAGG + Intergenic
1009233878 6:61098584-61098606 AATAAGGAAAAAATGGAGCAAGG - Intergenic
1009350760 6:62675245-62675267 TTTAGAGCACAAAGGGAGAAAGG + Intergenic
1009450400 6:63793089-63793111 GTTCTGGCCCAAATGGAGCATGG - Intronic
1011774960 6:90719582-90719604 TTTAACTCATAGATGGAGCATGG - Intergenic
1013229040 6:108144734-108144756 TTTTAAACACAAATGGAGCTGGG + Intronic
1014643064 6:123937963-123937985 TTCAAGGCCCAAGAGGAGCAAGG - Intronic
1015800064 6:137051762-137051784 TTTAATGAACAAATGGAGGATGG + Intergenic
1016947536 6:149548242-149548264 TATCAGGCATAAATGGAACATGG - Intergenic
1017026284 6:150184244-150184266 TTTAAGGCACAAATGGAGCATGG + Intronic
1017522050 6:155211117-155211139 TTAAAGGCTCACATGGAGAAAGG - Intronic
1018143876 6:160864999-160865021 TTGAAGGGACAAATGAAACATGG - Intergenic
1018507018 6:164482858-164482880 TTAAAGGCTCAAATGCAGAAGGG - Intergenic
1019413411 7:916566-916588 TTTAAGGCAGGAGTGGAGCGAGG + Intronic
1022129997 7:27396157-27396179 TTTCAGGCACACAGGGAGAAGGG + Intergenic
1022958960 7:35407218-35407240 TTTAAGACATCAATGGAGGAAGG + Intergenic
1031010768 7:116524522-116524544 TTTAAGGCAGAGATGGAACTTGG + Intergenic
1032611649 7:133421609-133421631 TTAAAGGCAAAAATGCTGCAAGG - Intronic
1034127871 7:148690135-148690157 TCTAATAAACAAATGGAGCAGGG + Intergenic
1037361356 8:18077962-18077984 TACAAGTCACTAATGGAGCAGGG - Intronic
1037405564 8:18538991-18539013 TTTAAGTCAGAAATGGGGCACGG - Intronic
1038075242 8:24065921-24065943 CTTAAGACACAAAATGAGCATGG - Intergenic
1039162471 8:34638255-34638277 TTTAAGGCACAAATTGGTCATGG + Intergenic
1041371654 8:57167181-57167203 TGAAAAGCACAAATGGAGCCAGG + Intergenic
1041506186 8:58600291-58600313 TCCAAGGGCCAAATGGAGCAGGG + Intronic
1042274948 8:66994421-66994443 TTAAAGGAACACATGTAGCAAGG - Intronic
1042567656 8:70128868-70128890 TCTCAGGCACAAATGGCCCAGGG - Exonic
1044164942 8:88970106-88970128 TCTAAGGCTCAAATAGAGGAGGG - Intergenic
1044522668 8:93217510-93217532 CCTGAGGCACAAAAGGAGCAGGG - Intergenic
1046306234 8:112371020-112371042 TTTAGGGTAGAAAAGGAGCAAGG + Intronic
1050313473 9:4377026-4377048 TTTGAGGCACAAAGGGGTCAGGG - Intergenic
1050768131 9:9162114-9162136 TTCTAGGCACAAATGGACAAAGG - Intronic
1052165418 9:25320453-25320475 ATTAAGACACAAATGCAGCCAGG + Intergenic
1053653428 9:40192179-40192201 TTTAAAGCACACATGGAGGGTGG - Intergenic
1053903830 9:42821469-42821491 TTTAAAGCACACATGGAGGGTGG - Intergenic
1054531156 9:66184039-66184061 TTTAAAGCACACATGGAGGGTGG + Intergenic
1055360207 9:75481537-75481559 TTTAAGGTACAAACAGAGGATGG + Intergenic
1059254955 9:112921446-112921468 TTCAAAGCATAAATGGAGGATGG + Intergenic
1187473496 X:19589629-19589651 TTTATGCCACACACGGAGCAAGG - Intronic
1190263425 X:48813958-48813980 CTGGAGGCCCAAATGGAGCATGG - Intronic
1190576018 X:51839554-51839576 TTTCTGGCAGAAATGGAGGAAGG - Intronic
1192998766 X:76540687-76540709 TTTCAGGCATAAATGAAACATGG - Intergenic
1194250310 X:91566705-91566727 TTTTGGGCTGAAATGGAGCAAGG - Intergenic
1196046935 X:111266312-111266334 TTTGAGGCACAAAGAGAACAAGG - Intronic
1200242197 X:154502810-154502832 CTGAAGGAACAAATGGAGGAAGG + Intergenic