ID: 1017026414

View in Genome Browser
Species Human (GRCh38)
Location 6:150185239-150185261
Sequence CAGGGTAGTTGTGAGGATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 460
Summary {0: 1, 1: 0, 2: 5, 3: 52, 4: 402}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017026408_1017026414 17 Left 1017026408 6:150185199-150185221 CCTCATCTATAACATGTCAACAA 0: 1
1: 0
2: 7
3: 86
4: 716
Right 1017026414 6:150185239-150185261 CAGGGTAGTTGTGAGGATGAAGG 0: 1
1: 0
2: 5
3: 52
4: 402

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017026414 Original CRISPR CAGGGTAGTTGTGAGGATGA AGG Intronic
900505126 1:3026353-3026375 GATGGTAGTGATGAGGATGATGG + Intergenic
900647222 1:3714440-3714462 CAGGGTGGGGGTGAGGATGGTGG + Intronic
900876601 1:5347359-5347381 GATGGTAGTGGTGATGATGATGG + Intergenic
901127089 1:6937250-6937272 GATGGTAGTGGTGATGATGATGG - Intronic
901127114 1:6937406-6937428 GATGGTAGTGGTGATGATGATGG - Intronic
901275894 1:7990570-7990592 GATGGTAGTGGTGAGGGTGATGG - Intergenic
901989452 1:13100866-13100888 GAGGGTATTGATGAGGATGAGGG - Intergenic
901992361 1:13125898-13125920 GAGGGTATTGATGAGGATGAGGG + Intergenic
902490163 1:16775630-16775652 CAGTGTTGTTGTGAGGCTGGAGG - Intronic
904092422 1:27954667-27954689 CAGGGCTGTGGTGAGGATGGAGG - Intronic
904307369 1:29598894-29598916 CAGGGTGGTTGTGAGGGCCACGG + Intergenic
904340512 1:29831036-29831058 CAGGGAAGCAGAGAGGATGAGGG + Intergenic
904396373 1:30225058-30225080 CAGGGTGGTTGTGAGGGCCACGG - Intergenic
904796847 1:33062607-33062629 CAGGGTAGATTGGAGGATAAGGG + Intronic
904896544 1:33822305-33822327 CTGGGTACCTGTGAGGATGCAGG + Intronic
904998912 1:34652814-34652836 GAGGCTGGTTGTGGGGATGAGGG - Intergenic
905356639 1:37389461-37389483 GAGGGTTGTTATGAGGATTAAGG - Intergenic
905685233 1:39902605-39902627 CAGGGTTGTTGTGAGGCTTCAGG + Intergenic
905697986 1:39990007-39990029 CAGGGTGGTAGTGATAATGATGG - Intergenic
905939502 1:41851990-41852012 TAGGGTGTTTGTGAGGATCAAGG + Intronic
906065223 1:42975651-42975673 CAGGGCTGTGGTGAGGATGAAGG + Intergenic
906284627 1:44578763-44578785 CAGGATATTTGTGAAGATCAAGG - Intronic
906711926 1:47937072-47937094 CATGGTAGTGGTGATGATGATGG - Intronic
906711942 1:47937195-47937217 CATGGTAGTGGTGATGATGATGG - Intronic
906711951 1:47937258-47937280 GATGGTAGTGGTGATGATGATGG - Intronic
907374011 1:54020871-54020893 CAGAGTTGTTGTGAGGATCAAGG - Intergenic
907376858 1:54051309-54051331 CAGGGTTGTTGTGAGAATTAGGG + Intronic
907714035 1:56911325-56911347 CAGGATTATTGTGAGGATTAAGG - Intronic
907949300 1:59165702-59165724 GATGGTTGTTGTGAGGATCAGGG + Intergenic
909115081 1:71523228-71523250 TTGGGTTGTTGTGAGGATGTTGG + Intronic
909363246 1:74789944-74789966 AAGAGTAGCTGTGATGATGATGG + Intergenic
910206239 1:84751602-84751624 CAGGGTGGTGGTGGGGAGGAGGG - Intergenic
910743696 1:90550295-90550317 CAGGGTTGTTTTGAGGATAAAGG - Intergenic
911101927 1:94102122-94102144 CAGGATTGTTGTGAGGAGTAAGG + Intronic
911696380 1:100895005-100895027 CAGGGAAGTTGTTTGGCTGAGGG - Exonic
912710867 1:111948798-111948820 CAGGGAAGTGGGGAAGATGAGGG + Intronic
914901420 1:151713223-151713245 CAGGGTGGGGGTGAGGAAGAAGG - Intronic
915629636 1:157142265-157142287 CAAGGTTGTTGTGAGGATAGAGG + Intergenic
915826861 1:159087284-159087306 CAGGGTGATGGTAAGGATGATGG + Intronic
915924024 1:160002551-160002573 CATGGAAGATGTGAGGGTGAGGG - Intergenic
916189785 1:162167549-162167571 CAGGGTGGTTGTGGGGCTGAGGG + Intronic
916454969 1:164961701-164961723 CAGGCCAGGTGTGAGGAGGAGGG - Intergenic
917328157 1:173854636-173854658 CAGGGTAGTGGTTAGGAGCATGG - Intronic
917747936 1:178028535-178028557 CAGGGGCTTTGTGAGGATCAAGG + Intergenic
918489764 1:185069033-185069055 CAGAGTAGTTATGAGGGAGAAGG - Intronic
918771190 1:188562527-188562549 CAGTGTGGGTGTGAGGAGGAGGG - Intergenic
919026637 1:192180213-192180235 AATGGTGGTTGTGATGATGATGG - Intronic
920190312 1:204189674-204189696 CTGGGTAGTTATGAGGATGAAGG + Intergenic
920192678 1:204203518-204203540 CAGGGCAATTCTGAGGAGGAAGG - Intronic
920325931 1:205163977-205163999 CTGAATAGTTGTGAGGAAGAAGG + Intronic
920349086 1:205325886-205325908 CAGGGTAATTGAGAGTTTGAGGG - Intergenic
920960939 1:210663550-210663572 TAAGGTGGTTGTGAGAATGAGGG + Intronic
922224231 1:223631427-223631449 CTGGGGAGGTGTGAGGAGGAAGG - Intronic
922846025 1:228684734-228684756 TAGAGTAGTTGTGAGGGTGAGGG + Intergenic
922940010 1:229454983-229455005 AAGGGTAGTTGTAAGGATTGAGG - Intronic
923530275 1:234806900-234806922 CAGTGTTGTTGTGAGGCTGGAGG + Intergenic
924445898 1:244130530-244130552 TAGGGTAGTTGAGGGGAAGAAGG - Intergenic
924593272 1:245423273-245423295 CAGGGTTACTGTGAAGATGAAGG - Intronic
1062945361 10:1457247-1457269 CAGAGGAGTGGTGAGCATGAGGG + Intronic
1063663296 10:8048240-8048262 CTGGGTGGCTGTGAGGATGTGGG + Intergenic
1063956215 10:11270094-11270116 CATTTTAGTTTTGAGGATGAGGG - Intronic
1064328717 10:14374344-14374366 CACGGTAGTTGTGAGGTCTAGGG + Intronic
1065702378 10:28437915-28437937 CAGGGTTGTTGGGAGAATTAAGG - Intergenic
1065992783 10:31029548-31029570 GAGGTTAGTTGTGGAGATGATGG - Intronic
1066046195 10:31597671-31597693 AAGGGTTGTTCTGAGGAAGAGGG + Intergenic
1066295982 10:34055106-34055128 CAGTGTCGTTGTGAGGATTTGGG - Intergenic
1067052392 10:43029375-43029397 CAGGGTGGAGGTGAGGGTGAGGG + Intergenic
1067080951 10:43211897-43211919 CAGGGTTGCAGTGAGGTTGAAGG + Intronic
1067564106 10:47324534-47324556 CAGGGTAAGTGAGAGGATTAAGG + Intronic
1067944187 10:50679965-50679987 CAGGGCGGTTGTGAGGGTGATGG + Intergenic
1068117648 10:52752002-52752024 CATGAGAGCTGTGAGGATGATGG + Intergenic
1068280904 10:54868448-54868470 GAGGATAGCTGTGAGGGTGAGGG - Intronic
1069707052 10:70465531-70465553 CAGGGTTATTTTGACGATGACGG - Intergenic
1069894811 10:71673766-71673788 CAGGGCTGTTGTGAGGGTGAAGG + Intronic
1069946109 10:71986915-71986937 CAGGGTTGTTGTGAGCATCAAGG - Intronic
1070865679 10:79706835-79706857 CAGGGCGGTTGTGAGGGTGATGG + Intronic
1070879472 10:79844966-79844988 CAGGGCGGTTGTGAGGGTGATGG + Intronic
1071568291 10:86682714-86682736 CAGGGTTATTGGGAGGATAAAGG + Intronic
1071632582 10:87229056-87229078 CAGGGCGGTTGTGAGGGTGATGG + Intronic
1071646032 10:87361274-87361296 CAGGGCGGTTGTGAGGGTGATGG + Intronic
1072215701 10:93285602-93285624 GAGGGTGGTGATGAGGATGAGGG + Intergenic
1072236673 10:93459878-93459900 CAGGGTAGTGGTAAGGTAGAGGG - Intronic
1072993307 10:100219444-100219466 CAGGGTAGTGGTGAGGACCTTGG + Intronic
1073438570 10:103537844-103537866 AAGGGAACTTGTGAGGGTGACGG - Intronic
1073473832 10:103740151-103740173 CAAGGTTGTTGCGAGGATGAAGG - Intronic
1073627581 10:105115272-105115294 GAAGGTTGTTGTGAGGATCAAGG + Intronic
1074538445 10:114345540-114345562 CAGGGTGGTTGTGAGAATTGAGG - Intronic
1074776636 10:116772098-116772120 GGGGGTAGTGGCGAGGATGATGG + Intergenic
1075405746 10:122194633-122194655 CAGGACAGTAGAGAGGATGATGG + Intronic
1075584234 10:123645571-123645593 CAGGGTGGTGGTGGTGATGATGG + Intergenic
1076125284 10:127969358-127969380 CAGGGTCGTCATGAGGATAAAGG + Intronic
1076179463 10:128395816-128395838 AAGGGTAGATGTGAGAATGATGG - Intergenic
1076795671 10:132797071-132797093 CAGGGGCGTTGGGAGGCTGAGGG - Intergenic
1077916551 11:6615394-6615416 CAGGGTAAGAGTGAGGATGGGGG - Intronic
1078131320 11:8616554-8616576 CAGGGTGTTTGTGAGGATACTGG - Exonic
1079114492 11:17632555-17632577 CAGGGTGGTTTTGAGGATGTGGG + Intronic
1079140408 11:17805501-17805523 CAGGGTTGTGGTGGGGCTGATGG - Intronic
1079994002 11:27276024-27276046 GAGGCTAGTTGTGAGCAGGATGG + Intergenic
1081616026 11:44591712-44591734 TGGGCTGGTTGTGAGGATGATGG + Intronic
1081735974 11:45404522-45404544 CAGGGTGGTGGTGAGGATTTGGG - Intergenic
1082830581 11:57614088-57614110 CAGGGTTGTTTTAGGGATGAGGG + Intronic
1083271279 11:61573933-61573955 CAAGGTGGTTCTGAGGATGGAGG + Intronic
1084686944 11:70701881-70701903 GAGGGTGGTGGTGATGATGATGG - Intronic
1085639041 11:78179731-78179753 CAGGGCAGGTGTCAGCATGAAGG - Intronic
1085727501 11:78967031-78967053 GGTGGTAGTTGTGAGGAGGAAGG - Intronic
1085729811 11:78987488-78987510 CAGGGTAGGTGAGTGCATGAAGG + Intronic
1085792147 11:79505404-79505426 TGGGGTTGTTGTGAGGATCAAGG - Intergenic
1086582381 11:88414163-88414185 CAGGGTGGTGGTGGGGAGGATGG - Intergenic
1087980659 11:104609640-104609662 CAGGGTCCTTGTGAGGGAGATGG - Intergenic
1089061478 11:115629548-115629570 GAGGGTGGAAGTGAGGATGAAGG + Intergenic
1089499762 11:118925294-118925316 CAGGGTCGTTGTGTGGATGGGGG + Intronic
1089941444 11:122422228-122422250 CAGGGTGGTTGTGAACATTAGGG + Intergenic
1090295744 11:125586219-125586241 GAGGGAAGTTGAGTGGATGAAGG + Intergenic
1090949517 11:131461078-131461100 AAGGGAAATTGTGAAGATGAGGG + Intronic
1091178365 11:133581358-133581380 CTGGTTAATTCTGAGGATGATGG + Intergenic
1091216606 11:133906222-133906244 CAGCGTGGTTGTGAGCATGTGGG - Intergenic
1091565485 12:1645092-1645114 CAGGGTATTTGACAGGATCAGGG + Intronic
1091766785 12:3126163-3126185 CAGGGATGTTGTGAGGGTTAAGG + Intronic
1092132248 12:6120705-6120727 CAGGGCTGTTGTGGGGATGCAGG + Intronic
1092696239 12:11174821-11174843 CAGGGTATATGTGAGAATTACGG - Intergenic
1092906200 12:13102074-13102096 CAGGCTGGTTGTGAGGATTAAGG - Intronic
1092931927 12:13324077-13324099 CAGGGTATTTATGAGGAGGAGGG - Intergenic
1093565684 12:20600341-20600363 CAGGCTAGCTTTCAGGATGAAGG - Intronic
1095493902 12:42764459-42764481 GAAGGTGGTGGTGAGGATGAGGG + Intergenic
1095596203 12:43961112-43961134 CAGGGTTGTTGTGACAATCAAGG + Intronic
1096919055 12:55064647-55064669 CAGGGTGGTTTTGAGAATGAAGG + Intergenic
1097220853 12:57450208-57450230 GAGGGTAGTGGTCAGGAAGATGG - Exonic
1097263847 12:57734853-57734875 CAGAGCAGTTGGGAGGATCAGGG + Intronic
1097734600 12:63167966-63167988 CAGGGTAGAAGAGAGGCTGAGGG - Intergenic
1097769201 12:63561389-63561411 CAGGGAACTTGTGGGGGTGATGG - Intronic
1098223234 12:68292556-68292578 AAGGATAGTTGTGACGATTAAGG - Intronic
1099118898 12:78663472-78663494 CAGGTAAGATGTGAGGAAGATGG - Intergenic
1100944007 12:99758481-99758503 CAGGATTGTTGTGAGGATAGAGG - Intronic
1101539937 12:105655590-105655612 AAAGGTAGTGGTGAGGATGAGGG + Intergenic
1101585953 12:106085954-106085976 CAAGCTAGTTGGGAGGCTGAGGG - Intronic
1101593499 12:106142391-106142413 CAGGGTTGGTATGAGGATTAAGG + Intergenic
1101746727 12:107547293-107547315 CCTGGTAGCTGTGAGGAAGATGG - Intronic
1101755658 12:107618846-107618868 CTGGGCAGTTGTTAGGGTGAGGG + Intronic
1102419463 12:112792349-112792371 AAGGGTAGTTGGGAGGAGAAGGG + Intronic
1102599553 12:114019062-114019084 CAGGGTATTTGTGAGGTCTAAGG + Intergenic
1103053324 12:117799758-117799780 AAGGGTGGTTGTGAGCATAATGG + Intronic
1103199532 12:119075874-119075896 GATGGTAGTAGTGATGATGATGG + Intronic
1103248647 12:119480701-119480723 GATGGTGGTGGTGAGGATGATGG - Intronic
1103696323 12:122818507-122818529 CTGGGTACTTGGGAGGTTGAGGG + Intronic
1103895262 12:124269043-124269065 GAGGGTATTAGTGGGGATGACGG - Intronic
1104064711 12:125297196-125297218 CAGGGTGGATGGGAGGAGGAGGG + Intronic
1104822379 12:131684573-131684595 CAGGGTAGTCGGGAGGGAGATGG - Intergenic
1104879016 12:132056355-132056377 CAGGATAGATGTGTAGATGATGG + Intronic
1105009038 12:132742768-132742790 GATGGTGGTAGTGAGGATGATGG - Intronic
1106599408 13:31174978-31175000 CAAGCTACTGGTGAGGATGATGG + Intergenic
1107944597 13:45406661-45406683 GAGGGGAGTTTTGAGGGTGAGGG - Intronic
1108260724 13:48653129-48653151 CAGGGTAGATGGGGGGATGCAGG + Intergenic
1109528959 13:63614875-63614897 CTGAGGAGATGTGAGGATGAAGG + Intergenic
1109941486 13:69372497-69372519 TAGGGTGGTTGTGAGTATTAAGG - Intergenic
1110796479 13:79644385-79644407 CAGGGTAGTAGTGAGGCTGAAGG - Intergenic
1111796930 13:92933429-92933451 CAGGTTGGTTGTGATGAAGATGG - Intergenic
1112203617 13:97302537-97302559 AGGGTTAGTTGTGAGGATTAAGG - Intronic
1112816035 13:103274740-103274762 TAGGGTTATTGTGAGGATTAAGG - Intergenic
1113523745 13:110957947-110957969 CGGGGTGGCTGTGAGGATGGAGG + Intergenic
1113701591 13:112392779-112392801 CGGGGTGGCTGTGAGGATGGAGG - Intronic
1114625982 14:24130731-24130753 CAGGGTAGTTGGTTGGAGGATGG + Intronic
1119010463 14:70981161-70981183 TAGGGTTGTTGTGAGGACTAAGG + Intronic
1119383951 14:74245674-74245696 CTGGGTAGCTGTGAAGAGGAAGG + Intronic
1119800668 14:77442210-77442232 CAGGGTTATTATGAAGATGAAGG - Intronic
1120956405 14:90087041-90087063 TAAGGTAGTGGTGAGGGTGAAGG - Intronic
1121721030 14:96108705-96108727 CAGTGTAGCTGTGAAGAGGAAGG - Intergenic
1121959025 14:98241341-98241363 CAGGGTAGTAGTGTGGATTCTGG + Intergenic
1121992745 14:98575345-98575367 CAGGGTCTTTATTAGGATGAAGG + Intergenic
1123905923 15:24921283-24921305 CAGGGAATTCGTGAGGATGCAGG + Intronic
1126399336 15:48253303-48253325 AATGGAACTTGTGAGGATGATGG - Intronic
1126588604 15:50316331-50316353 TAGAGTTGTTGTGAGGATTATGG + Intronic
1127531215 15:59845378-59845400 CAGGGTAGTTCTGAGGGTTTGGG + Intergenic
1129113180 15:73350188-73350210 AAGGGTGGTTGGGAGGATGTAGG - Intronic
1129633964 15:77294547-77294569 CAGGGTTGTTCTGAGAATAAAGG + Intronic
1129923352 15:79339593-79339615 CATGGTAGTGGTCATGATGAGGG + Intronic
1130435090 15:83890167-83890189 CAGGGTAGTAGTGACAATAATGG - Exonic
1130827424 15:87563883-87563905 AAGGGAAGTTGTGAGGAATAAGG - Intergenic
1130879473 15:88042747-88042769 CAGGGTTGTGGTGATGATTAAGG - Intronic
1131132368 15:89908488-89908510 TAGGGTAGATGTGAGGTTGGCGG - Intronic
1131302011 15:91207911-91207933 CAGGGGAGAAGTGAGGAAGAAGG + Intronic
1132989981 16:2787409-2787431 GAGGGAAGTGGTGAAGATGAGGG - Intronic
1133396636 16:5452593-5452615 CTGGGTAGCAGTGTGGATGAGGG - Intergenic
1134149983 16:11797675-11797697 CACGGTTGTTCTGAGGATGCAGG - Intergenic
1134380077 16:13715993-13716015 CTGGGTGGTTGTGAGGACCAAGG - Intergenic
1134583192 16:15389079-15389101 GAGTGTAGCAGTGAGGATGACGG - Intergenic
1134691446 16:16193198-16193220 GAGTGTAGCAGTGAGGATGACGG - Intronic
1135174398 16:20215257-20215279 CAGGGTAGTTCTGGGGAGGAGGG + Intergenic
1135532428 16:23265975-23265997 CAGCTTAGTCGTGAGGATCAGGG + Intergenic
1136362553 16:29790373-29790395 CAGGGTCGTTGTGTGGATCGTGG - Intergenic
1138168256 16:54823218-54823240 CAGGGTGGTTTTGAGGGTTAAGG - Intergenic
1139505452 16:67396163-67396185 CAGGGTTGCTGTGAAGATCAGGG - Intronic
1139721643 16:68860833-68860855 GAAGGTGGTTGTGAGGATTAAGG + Intronic
1139858876 16:70004231-70004253 GAGTGTAGCAGTGAGGATGACGG - Intergenic
1141450414 16:84096358-84096380 CAGGGAATTTCTGAGGGTGATGG + Intronic
1142064374 16:88052646-88052668 TAGGGTGGTTGTGATGATGGTGG - Intronic
1142111008 16:88331509-88331531 GATGGTAGTGATGAGGATGATGG - Intergenic
1142324357 16:89404779-89404801 CAAGGTCATTCTGAGGATGAAGG + Intronic
1142623426 17:1179020-1179042 GAGGGTGGTGGTGATGATGAGGG + Intronic
1142962366 17:3558830-3558852 CAGGCAGGTTGTGATGATGAGGG - Intergenic
1143393506 17:6574596-6574618 CAAGGTTTTTGTGAGGATTAAGG - Intergenic
1143786428 17:9259217-9259239 CAGGCTTGTTGTGAGGATTTCGG + Intronic
1147873113 17:43601788-43601810 CAGGGTAATCGTGAGGAGGCAGG - Intergenic
1149121380 17:53170535-53170557 CAGGTTAGGTGTAAGAATGATGG + Intergenic
1149403949 17:56327916-56327938 GAGGGTTTATGTGAGGATGAGGG + Intronic
1149406575 17:56357869-56357891 CAAGCCAGTTGTGAGGATCAAGG - Intronic
1149523483 17:57336143-57336165 CAGGGTGGTGGTGAGGACGGTGG + Intronic
1149999681 17:61425934-61425956 CAGGGTTATTGTGAGGGTTAGGG + Intergenic
1150006018 17:61469514-61469536 CTGGGTAAGTGTGGGGATGAAGG - Intronic
1150788731 17:68183259-68183281 ACGGGTTGTTCTGAGGATGAAGG - Intergenic
1151986470 17:77547169-77547191 CAGGGTGGCTGTGCTGATGACGG + Intergenic
1152022050 17:77785108-77785130 CAGGCCAGTTCTGAGGATGGGGG - Intergenic
1152179889 17:78812841-78812863 AAAGGTATTTGTGAGAATGATGG - Exonic
1154947576 18:21177309-21177331 AAGGGAACTTTTGAGGATGATGG + Intergenic
1155881151 18:31150258-31150280 GATGGTAGTGGTGATGATGATGG - Intronic
1157576655 18:48748260-48748282 TAGGGTTGCTGTGAGGATCAAGG + Intronic
1158393490 18:57062217-57062239 CAGGGGATTTCAGAGGATGAGGG + Intergenic
1158881583 18:61784151-61784173 CAGGGCTGTTGTGAAGATTAAGG - Intergenic
1161536886 19:4824968-4824990 AAGGGTGGTGGTGAGGAGGAGGG + Intronic
1162842991 19:13370019-13370041 CAGGCTTGTTGGGAGGATAAAGG + Intronic
1165658774 19:37556478-37556500 CATTGGCGTTGTGAGGATGATGG + Intronic
1165712413 19:38021421-38021443 CAGGGTAGTTCTGGGGACAAGGG + Intronic
1166630232 19:44400225-44400247 CAGAGTAGTTGTCAGGGTGAGGG - Intronic
1166637228 19:44461211-44461233 CAGAGTAGTTGTCAGGGTGAGGG + Intergenic
1167148723 19:47696871-47696893 CATGGCTGTTGGGAGGATGATGG + Intronic
1167526298 19:49985979-49986001 CAGAGCAGTTGTGAGGATGCAGG + Intronic
1168148764 19:54433915-54433937 CAGGGCTGTTGTGAGGATGAAGG + Intronic
1168191696 19:54742990-54743012 CAGAGGAGTGGTGAGAATGATGG + Intronic
1168193970 19:54759622-54759644 CAGAGGAGTGGTGAGAATGATGG + Intronic
1168196015 19:54774347-54774369 CAGAGGAGTGGTGAGAATGATGG + Intronic
1168585700 19:57589900-57589922 CAGGTTTGTTTTGAGGATAATGG - Intronic
925739855 2:6995937-6995959 CAGAGGTGTTCTGAGGATGAAGG - Intronic
926147398 2:10405062-10405084 CTGAGCAGTTGTGAGGATAAAGG - Intronic
926849114 2:17175264-17175286 CGGGGTTGTTGAGAGGATAATGG - Intergenic
926974152 2:18496476-18496498 CAGGGTTGTGGTAAGGATTATGG - Intergenic
927211549 2:20642075-20642097 GAGGGTAGGTGCCAGGATGATGG - Intronic
927915498 2:26933470-26933492 CAGGGCAGCTCTGAGGAAGACGG - Intronic
928273275 2:29876432-29876454 GATGGTAGTGGTGAGGATGATGG + Intronic
928600860 2:32901992-32902014 CAGGATGCTTGTGGGGATGATGG - Intergenic
929042663 2:37760739-37760761 CAGGATTGTAGTGAGGGTGATGG - Intergenic
929886642 2:45884392-45884414 CAGGGTGGTGGTGAGGAAGGAGG + Intronic
931405517 2:61973878-61973900 CAGGGGTGTTGATAGGATGATGG - Intronic
932884844 2:75540202-75540224 CAGGGTGTTTGTGAGGATGCAGG + Intronic
936697875 2:114972533-114972555 CAGGGTGGATCTCAGGATGATGG + Intronic
937064830 2:119010097-119010119 CAGAGTTGTTATGAGGACGAGGG + Intergenic
937399214 2:121567098-121567120 CAAGATGGTTGTGAGGATGAAGG + Intronic
937877083 2:126833863-126833885 CACAGGTGTTGTGAGGATGAGGG - Intergenic
938543529 2:132306279-132306301 CAGAGTAGTTGTCAGTTTGAGGG + Intergenic
938551848 2:132390010-132390032 GAGGGTGGATGTTAGGATGAAGG - Intergenic
941252629 2:163185319-163185341 CATGGTTGTTGTAAGGATTAAGG - Intergenic
941729401 2:168899319-168899341 CAGAGGAGTGGTGAGGATGCTGG + Intronic
941892759 2:170598670-170598692 GAGTGTAGTTGTAAGGATGTGGG + Intronic
942810812 2:179998369-179998391 CAGGGTAATTATGAGGATTGAGG - Intronic
944657603 2:201891566-201891588 CAGGGTAATCTTGAGGAGGAAGG + Intronic
944879836 2:204001464-204001486 TAGGGTAGTTGTGAAGATTAGGG + Intergenic
945939314 2:215932458-215932480 CAGCAAAGTGGTGAGGATGAAGG - Intergenic
947158085 2:227183926-227183948 CAGGGCTGTTGTGAGAATCAAGG - Intronic
947796527 2:232896927-232896949 GAGGGTAGGGGTGAGGGTGAGGG + Intronic
947849948 2:233278485-233278507 CAGGGCTGTTGTGATGATCAGGG - Intronic
948180212 2:235973562-235973584 AAGGGTGGTGATGAGGATGAGGG + Intronic
949006500 2:241652330-241652352 CAGGGTAGCTGTGAAGGAGATGG - Intronic
1169269257 20:4186907-4186929 GAGGGTGGTTGTAAGGATTAAGG - Intronic
1170066927 20:12321545-12321567 CAGTGCAGTTGAGAGAATGAAGG - Intergenic
1170446655 20:16434940-16434962 CAGTGTGGCTGTGAGGATGGGGG + Intronic
1170837268 20:19895067-19895089 AAGGGTGGTTGGGAGGCTGATGG - Intronic
1171260173 20:23725028-23725050 AATGGTAGTTATGAAGATGATGG - Intergenic
1171872393 20:30538984-30539006 CAGAGTAGTTGTCAGGTTGAGGG + Intergenic
1172609517 20:36239688-36239710 CAGGGTTGTCATGAGGATTAAGG + Intronic
1173331623 20:42080299-42080321 CAGGTTAGGTGTGAGGATGGGGG + Exonic
1173332765 20:42088809-42088831 TAGGGTTGTTCTGAGGATAAAGG + Intronic
1173868487 20:46327943-46327965 CTGGGCTGTTGTTAGGATGAGGG + Intergenic
1174278913 20:49424372-49424394 CAGGGGTGATGTGAGTATGACGG - Intronic
1175594071 20:60216412-60216434 CAGGCTAGGTGTGGGGTTGACGG - Intergenic
1175674460 20:60934784-60934806 CAGGGTTATTGTGATGATCAAGG - Intergenic
1175683209 20:61006415-61006437 CTGGGTAGATTTAAGGATGAGGG + Intergenic
1175799819 20:61795137-61795159 GATGGTAGTGGTAAGGATGATGG + Intronic
1176169877 20:63691962-63691984 CAGGGCAGCTGTGATGCTGACGG + Intronic
1177471056 21:21561598-21561620 CAAGGTAGTTGTAATAATGATGG - Intergenic
1178882802 21:36462187-36462209 CTGGGCGGTTGTCAGGATGAGGG + Intronic
1179046161 21:37847241-37847263 CAGGGTCCTTGTGAGAATTAAGG - Intronic
1179261704 21:39763675-39763697 CAGGGTGAGTGTGGGGATGATGG - Intronic
1179514148 21:41894854-41894876 CATGGTGGTTGTGAGGGTCAAGG + Intronic
1181054105 22:20251894-20251916 AAGGATAGTGGTGATGATGATGG - Intronic
1181460434 22:23083036-23083058 CAGGGAAGTTGGGAGAGTGAAGG + Intronic
1182930703 22:34171516-34171538 CAGTGTAGTTGTTATGATCATGG - Intergenic
1184529143 22:45043367-45043389 CAGGGAAGGTGTGGGGAGGAGGG + Intergenic
1184702156 22:46182584-46182606 CAGGAGAGCTTTGAGGATGATGG + Intronic
1185060721 22:48605254-48605276 GAGGGTGATGGTGAGGATGATGG + Intronic
950022030 3:9793820-9793842 CAGGGAAGGTGTGACGAAGAGGG - Intronic
950197551 3:11019786-11019808 TAGGGTTCTTGTGAGGATTAAGG + Intronic
950624725 3:14236733-14236755 GAGGGATGTTGTGGGGATGAAGG - Intergenic
950726708 3:14921657-14921679 CAGGGCTGCTGTGGGGATGAAGG - Intronic
951145592 3:19222785-19222807 CAGGATATTTTTTAGGATGAAGG + Intronic
951702494 3:25510219-25510241 AAGGGTAGTTGAAAGGATGCTGG - Intronic
952866261 3:37857186-37857208 GATGGTAGTTGTGAGGATTAAGG - Intergenic
952927823 3:38334710-38334732 TAGGTTTGTTGTGAGGATGTGGG + Intergenic
953300916 3:41775060-41775082 CAGGGACGTTGTGAGGTGGAGGG + Intronic
953903128 3:46854516-46854538 CAGGGTACTGGTGGGGGTGATGG - Intergenic
954608909 3:51933987-51934009 CAGTGAGTTTGTGAGGATGAAGG + Intronic
955987140 3:64585344-64585366 AGAGGTAGTTGTGAGAATGAGGG + Intronic
956145058 3:66183824-66183846 CAGGGTGAGGGTGAGGATGAAGG - Intronic
956145416 3:66186698-66186720 CAGGGTAAGAGTAAGGATGAAGG - Intronic
956352798 3:68356333-68356355 AAGGGTGGTTGTGAGTATAAAGG + Intronic
956739606 3:72265383-72265405 CAGGGTAGATGTCAGGCTGATGG - Intergenic
959814895 3:110663808-110663830 AAGAGTTGTTATGAGGATGAAGG - Intergenic
961924254 3:130460663-130460685 CATGGTAGTAGTGAAGATGATGG + Intronic
962274900 3:134004708-134004730 CATGCTAGTTTTGAGGATGGAGG + Intronic
962843199 3:139253572-139253594 CAGAGTTGTTGTGAAGATCAAGG - Intronic
963266312 3:143243366-143243388 CAGAGTAATTGTGAGGATGCAGG + Intergenic
964085106 3:152807666-152807688 CTGGAAAGTTGTGAGGGTGAGGG - Intergenic
964381633 3:156103532-156103554 CAGGGTGGTTTGGAGAATGAGGG + Intronic
965730549 3:171767718-171767740 TAAGGTTGTTGTGAGGATTAAGG + Intronic
965915137 3:173835931-173835953 CAGTGCGGTTGTGAGGATCAAGG - Intronic
966724710 3:183099242-183099264 CAGGGTCGGTGTGGGGAGGACGG - Intronic
967211493 3:187174277-187174299 CAGGGTTCTTATGAGGATAAAGG - Intronic
967337363 3:188359609-188359631 CTGGGTAGTTGAGGGGATTAAGG - Intronic
967597724 3:191347324-191347346 CAGGGGAGTTCTAAGGATGTGGG + Intronic
968287355 3:197516867-197516889 CAGGGTGGTTGTGAGGATCAGGG - Intronic
968548628 4:1211153-1211175 CCGGGCCGTTGTGTGGATGATGG - Intergenic
969347694 4:6579599-6579621 CATTGTAGTGGTGAAGATGATGG - Intronic
969373796 4:6750071-6750093 CAGGGCAGGTGTGGGGATGGGGG + Intergenic
969521248 4:7678923-7678945 CAGGGTTGCTGTGAGGTTTAAGG + Intronic
969628514 4:8321284-8321306 GAGGGTAATGGTGATGATGATGG - Intergenic
970498961 4:16657330-16657352 CAGGGTAATAATGATGATGATGG - Intronic
970795443 4:19907208-19907230 CAGGGTAGTTTTAAGCATAATGG - Intergenic
972160665 4:36222931-36222953 CAGGGAATTTATGAGGAAGAAGG - Intronic
972298617 4:37764227-37764249 CAGTGTATTTGTCAGGATAAAGG - Intergenic
973795876 4:54425833-54425855 AAGGGTAGTTGTAAGGATCAAGG + Intergenic
975738625 4:77406507-77406529 CATGGTAGTTATGGGGATGTGGG - Intronic
976700293 4:87962639-87962661 CAGGGTAGGGATGAGGGTGAAGG + Intergenic
977571399 4:98633019-98633041 CAGGGCAGTTGGGAGGATGGAGG + Intronic
977679544 4:99784254-99784276 CAGGGTCGTTATGATGAAGATGG - Intergenic
978388583 4:108201491-108201513 GAGGGTTGTTGTGAGTATTAAGG - Intergenic
979427605 4:120586662-120586684 GAGGGTAGTGGTGGGGATGTGGG + Intergenic
980091330 4:128446001-128446023 CAGGGTTCTTGTGAGGGTTAAGG + Intergenic
980876655 4:138668433-138668455 CAGGGAAGTTCTGAGCATCAAGG + Intergenic
981509572 4:145541109-145541131 CAGGTTAGTGGTGAGGAGGAAGG - Intronic
982118367 4:152116336-152116358 CAGGGTAGGTGAGATAATGAAGG - Intergenic
984532996 4:180940540-180940562 CAGGGTAGTTATGATTGTGAGGG + Intergenic
985606144 5:859037-859059 CATGGCAGTTGGGAGGATGAGGG + Intronic
986365805 5:7029496-7029518 TAGGGTTGTTTTGAGGATCAAGG + Intergenic
987062002 5:14251752-14251774 GAGGGAAGGTGTGAGGATGGGGG + Intronic
987267414 5:16271287-16271309 AAGGGTAGTTGGGAGGTTGTGGG + Intergenic
988480644 5:31627621-31627643 TAGGGTTGTGGTGAGGATAATGG - Intergenic
988903611 5:35761311-35761333 GAGGGTTGTTGTGAAGATTATGG + Intronic
989663044 5:43820393-43820415 AATGGTGGTTGTGAGGATTAAGG + Intergenic
991416286 5:66396408-66396430 TAGGGTTGTTGTGAGGGTGGTGG - Intergenic
993639963 5:90390792-90390814 CAGGTTACTTTTGAGAATGAAGG - Intergenic
994413774 5:99442365-99442387 GATGGTGGTTGTGAGGATAATGG - Intergenic
996786256 5:127239892-127239914 CTGGGTAGAAGTAAGGATGAGGG - Intergenic
997978955 5:138457375-138457397 CAGGGTGGTTGGGAGGCTGATGG - Intergenic
998483235 5:142480151-142480173 TAGAGTAGTTGAGAGGCTGAGGG + Intergenic
998528799 5:142866434-142866456 CAGAATGGTTGTGAGGATGGAGG + Intronic
999871873 5:155760159-155760181 GAGGGTGTTGGTGAGGATGATGG - Intergenic
999871879 5:155760195-155760217 GAGGGTGTTGGTGAGGATGATGG - Intergenic
999871917 5:155761433-155761455 GAGGGTGATGGTGAGGATGATGG - Intergenic
999871922 5:155761457-155761479 GAGGGTGATGGTGAGGATGATGG - Intergenic
999871936 5:155761539-155761561 GAGGGTGATGGTGAGGATGATGG - Intergenic
1001515125 5:172350263-172350285 CTGGGCTGCTGTGAGGATGAGGG + Intronic
1002054788 5:176592573-176592595 GATGGTAGTTGTGATGATGGTGG + Intronic
1002424790 5:179168493-179168515 CAGGGTTGCTGTGGGGGTGAGGG + Intronic
1003565386 6:7217648-7217670 GAAGGCTGTTGTGAGGATGAAGG + Intronic
1004589153 6:17031848-17031870 CAGGGAAGTTGTGGGGAGGGTGG + Intergenic
1005057947 6:21747210-21747232 CAGGGTTGTTATAAGGATTAAGG + Intergenic
1005636879 6:27761303-27761325 CATGGTATTTATGAGGATGTGGG + Intergenic
1006211210 6:32396489-32396511 CAGGGTTGCTGTGAGGCTCAGGG + Intronic
1006838143 6:37011570-37011592 CGGGGTTGCTGTGAGGATGCCGG + Intronic
1006935155 6:37712124-37712146 CAGGGTGGCTGGGAGGATGCGGG - Intergenic
1010014074 6:71083991-71084013 CAGGGTTGCTGAGAGGATTAAGG - Intergenic
1010967320 6:82226225-82226247 CAGGGCTGTTGTGAGGCTTAAGG + Intronic
1011248241 6:85342406-85342428 AAGGGTAGTTGTGAGGGAGGGGG - Intergenic
1012247046 6:96937725-96937747 AAGGGCAGCTGTGAGGATGGAGG - Intronic
1014038609 6:116797815-116797837 TAATGTAGTTGTGAGGATAATGG + Intronic
1014865561 6:126525339-126525361 CAGGGTGGTTGTGAAGCTGGAGG + Intergenic
1015425958 6:133067670-133067692 CTGGGGAGTAGTGAGGTTGAGGG + Intergenic
1015482630 6:133730063-133730085 CAGAGTAGATATGAGGATAATGG + Intergenic
1016272211 6:142302058-142302080 CAGGGAAGTTGGCAGGGTGAGGG - Exonic
1016589316 6:145727443-145727465 CAGTGTTGTTGTGAGGACAAAGG + Intronic
1017026414 6:150185239-150185261 CAGGGTAGTTGTGAGGATGAAGG + Intronic
1017720184 6:157238381-157238403 GATGGTTGTGGTGAGGATGAGGG + Intergenic
1020327941 7:6990102-6990124 CATTGGCGTTGTGAGGATGACGG + Intergenic
1021636937 7:22703279-22703301 GAGGGGAGGTGTGAGGTTGAGGG + Intergenic
1023803562 7:43855231-43855253 CAGGGTCATGGTGAGGATAAGGG + Intergenic
1024312108 7:47979260-47979282 GAGGGCACTTGTGGGGATGAAGG - Intronic
1024330556 7:48150566-48150588 CAGGGTCATTGTGAAGATCAAGG + Intergenic
1024705185 7:51949813-51949835 CAGGATAGTTGTGAGACTAAAGG - Intergenic
1026307200 7:69152567-69152589 AAGGGCAGATGTGAGGGTGATGG - Intergenic
1026911492 7:74094061-74094083 CGGGGCAGTTCTGAGGATGCTGG + Intronic
1028309335 7:89310825-89310847 CAGGGAGGTTGTGACCATGAAGG + Intronic
1029824583 7:103176141-103176163 CAGGGAACTTGTGGGGGTGATGG - Intergenic
1029982763 7:104894768-104894790 CAGGGTGGTTTTGAGGAATAAGG - Intronic
1030522733 7:110618416-110618438 CAGGGTAGTAGGGAGGACCATGG - Intergenic
1032374659 7:131399759-131399781 CAGTGTAGTTTTGAGGAGAAGGG + Intronic
1032469286 7:132166562-132166584 CAAGGTAGTTGGGAGGCTGCCGG + Intronic
1033176479 7:139128532-139128554 CAAGGTAGTTGTGATAAGGAGGG - Intergenic
1034349449 7:150406641-150406663 CAGGGCTGTTGTGAGGACAATGG + Intronic
1035064652 7:156095883-156095905 CAGGGAAGGTTTGAGGCTGATGG - Intergenic
1035659641 8:1337332-1337354 GATGGTAATAGTGAGGATGATGG + Intergenic
1037106718 8:15117620-15117642 CATGGTGGTTGTGAGGATCTTGG + Intronic
1037862715 8:22417206-22417228 CATGGTAGTTGTGAGGAAGGGGG + Intronic
1039255262 8:35711639-35711661 CAGGTTAAGTGTTAGGATGAGGG - Intronic
1039381708 8:37091936-37091958 CGGGGATGTTGGGAGGATGAAGG - Intergenic
1043146321 8:76660291-76660313 CAGGCTAGATGTCAGAATGATGG - Intergenic
1044006834 8:86947888-86947910 CAGGGTGGTTGGGAGGAGGTAGG - Intronic
1044562207 8:93623937-93623959 CAGGGTAGCTGAGAGCAGGAAGG - Intergenic
1045545734 8:103126605-103126627 CAGGGTCCTTGAGAAGATGAAGG - Intergenic
1046112477 8:109742090-109742112 TAGGGTTGTTTTGATGATGAAGG - Intergenic
1046202138 8:110941091-110941113 CATTGTAGTTGTGATTATGAGGG + Intergenic
1046800974 8:118426247-118426269 CAGGCTTGTTGGGAGGATTAAGG - Intronic
1047019243 8:120757119-120757141 CAGTGTTGTTGTAAGGATTAGGG - Intronic
1047695209 8:127396506-127396528 CAAGGTGGTTGTGAGGATTAAGG + Intergenic
1047762097 8:127961942-127961964 CAGGTTTGTTGTGAGGACGAAGG + Intergenic
1048609130 8:136002952-136002974 CAGTGTAGTGGTGAAGATTAAGG - Intergenic
1049063568 8:140295291-140295313 GAGGGTGGTTTTGAGGATCAAGG - Intronic
1051336480 9:16070573-16070595 CAGGGTGGGTGTGAGGAAGGAGG + Intergenic
1053056207 9:34994389-34994411 AAAGGGAGTTGGGAGGATGAGGG - Intronic
1053150403 9:35739537-35739559 CAGGGTATTGGTTAGGATGAGGG - Intronic
1053575924 9:39357521-39357543 CAGGGCAGTTGTGAGGACTGTGG + Intronic
1053840440 9:42185458-42185480 CAGGGCAGTTGTGAGGACTGTGG + Intronic
1054097493 9:60916212-60916234 CAGGGCAGTTGTGAGGACTGTGG + Intergenic
1054118896 9:61191842-61191864 CAGGGCAGTTGTGAGGACTGTGG + Intronic
1054588856 9:66990720-66990742 CAGGGCAGTTGTGAGGACTGTGG - Intergenic
1054897193 9:70327970-70327992 CAGAGTAGGAGAGAGGATGAGGG + Intronic
1054923848 9:70568715-70568737 CAAGGTAGTGGTTAAGATGATGG - Intronic
1055976297 9:81958387-81958409 GAGGGTAGATGTGAGGAGGCAGG + Intergenic
1055986864 9:82061882-82061904 CAGGGCAGTTGTGAGGACTGTGG - Intergenic
1056110224 9:83388008-83388030 CAGGGCAGTGGTGGGGATGTGGG - Intronic
1056459399 9:86794997-86795019 CAGGGTACTTCTGAGTGTGAAGG + Intergenic
1056584526 9:87919682-87919704 CAGGGCAGTTGTGAGGACCGTGG + Intergenic
1056612340 9:88133238-88133260 CAGGGCAGTTGTGAGGACCGTGG - Intergenic
1057160310 9:92884332-92884354 CAGGGCAGTTGTGAGGACTATGG + Intergenic
1057354937 9:94325122-94325144 CAGGGCGGTTGTGAGGGTGATGG - Intronic
1057652815 9:96932512-96932534 CAGGGCGGTTGTGAGGGTGATGG + Intronic
1057950334 9:99364701-99364723 CAGGGCTGTTGTGAGGACGTGGG + Intergenic
1058438239 9:104983640-104983662 CAAGGTTGTTGTGAGGATTAAGG - Intergenic
1059351478 9:113668489-113668511 CAGTGTAGTTTGGAGGATCAGGG - Intergenic
1060846374 9:126840808-126840830 CAGGGTTGGTGTCAGGGTGAAGG + Intergenic
1060846568 9:126842266-126842288 CAGGGTTGGTGTCAGGGTGAAGG - Intergenic
1061057830 9:128233631-128233653 CAGGGTAGCCCTGAGTATGAGGG + Intronic
1061635492 9:131905849-131905871 CTGGGTAGATGGGAGGAAGAAGG - Intronic
1061918213 9:133768292-133768314 CTGGGCTGCTGTGAGGATGAGGG + Intronic
1061957934 9:133973267-133973289 CAGAGTGGGTGTGAGGATGCAGG - Intronic
1062283749 9:135763824-135763846 CAGGGCCGCCGTGAGGATGAAGG - Intronic
1062547930 9:137072085-137072107 CAGGGTAGGTGTGGGGATGGGGG - Intergenic
1187477616 X:19626011-19626033 CGGGGTTGCTGTGAAGATGAGGG + Intronic
1187490740 X:19748822-19748844 CTGGGTAATTGGGTGGATGATGG - Intronic
1188081874 X:25853055-25853077 CAAGGCAGGTTTGAGGATGAGGG - Intergenic
1188085265 X:25895384-25895406 CAGGGTAATTGTGATTATCAAGG + Intergenic
1188617656 X:32178608-32178630 CAGGGTAGTTGTGAGGAAATGGG - Intronic
1189166660 X:38867517-38867539 CAGGCTACTTGGGAGGCTGAGGG - Intergenic
1192158650 X:68766563-68766585 CAGGGTTGTTGTGAGGATTATGG + Intergenic
1192181108 X:68916358-68916380 CAGAGTGGCTGTGACGATGAAGG - Intergenic
1192210768 X:69126418-69126440 CAGGGCTGAGGTGAGGATGAAGG - Intergenic
1192478863 X:71467677-71467699 CAAGGTTATTGTGAGGATTAAGG - Intronic
1192549684 X:72044029-72044051 CAGGCTAGTTGAGAGGACGGTGG + Intergenic
1194260935 X:91694861-91694883 CAGTTTTGTTGTGAGGATTAAGG - Intergenic
1196509738 X:116494937-116494959 AAGGGTAGTGGTGTGGTTGAGGG - Intergenic
1197487089 X:127066101-127066123 AAGGGTAGTTGGGAGGGGGAAGG - Intergenic
1197717785 X:129721958-129721980 TAGGGTGGTTGTGAGCATGTAGG + Intergenic
1199611983 X:149626120-149626142 CAGGGTTGTTGTAAAGATCATGG + Intronic
1200579588 Y:4933663-4933685 CAGTTTTGTTGTGAGGATTAAGG - Intergenic