ID: 1017026975

View in Genome Browser
Species Human (GRCh38)
Location 6:150189939-150189961
Sequence CCCTCCAGGCATCTACAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 154}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017026962_1017026975 -1 Left 1017026962 6:150189917-150189939 CCCCAACCCCCCAACACAGAACC 0: 1
1: 0
2: 2
3: 46
4: 551
Right 1017026975 6:150189939-150189961 CCCTCCAGGCATCTACAGGAGGG 0: 1
1: 0
2: 0
3: 11
4: 154
1017026961_1017026975 0 Left 1017026961 6:150189916-150189938 CCCCCAACCCCCCAACACAGAAC 0: 1
1: 0
2: 4
3: 107
4: 1128
Right 1017026975 6:150189939-150189961 CCCTCCAGGCATCTACAGGAGGG 0: 1
1: 0
2: 0
3: 11
4: 154
1017026963_1017026975 -2 Left 1017026963 6:150189918-150189940 CCCAACCCCCCAACACAGAACCC 0: 1
1: 0
2: 0
3: 22
4: 363
Right 1017026975 6:150189939-150189961 CCCTCCAGGCATCTACAGGAGGG 0: 1
1: 0
2: 0
3: 11
4: 154
1017026969_1017026975 -10 Left 1017026969 6:150189926-150189948 CCCAACACAGAACCCCTCCAGGC 0: 1
1: 0
2: 2
3: 17
4: 212
Right 1017026975 6:150189939-150189961 CCCTCCAGGCATCTACAGGAGGG 0: 1
1: 0
2: 0
3: 11
4: 154
1017026965_1017026975 -7 Left 1017026965 6:150189923-150189945 CCCCCCAACACAGAACCCCTCCA 0: 1
1: 0
2: 6
3: 36
4: 294
Right 1017026975 6:150189939-150189961 CCCTCCAGGCATCTACAGGAGGG 0: 1
1: 0
2: 0
3: 11
4: 154
1017026966_1017026975 -8 Left 1017026966 6:150189924-150189946 CCCCCAACACAGAACCCCTCCAG 0: 1
1: 0
2: 0
3: 25
4: 221
Right 1017026975 6:150189939-150189961 CCCTCCAGGCATCTACAGGAGGG 0: 1
1: 0
2: 0
3: 11
4: 154
1017026967_1017026975 -9 Left 1017026967 6:150189925-150189947 CCCCAACACAGAACCCCTCCAGG 0: 1
1: 0
2: 1
3: 23
4: 360
Right 1017026975 6:150189939-150189961 CCCTCCAGGCATCTACAGGAGGG 0: 1
1: 0
2: 0
3: 11
4: 154
1017026964_1017026975 -3 Left 1017026964 6:150189919-150189941 CCAACCCCCCAACACAGAACCCC 0: 1
1: 0
2: 0
3: 47
4: 514
Right 1017026975 6:150189939-150189961 CCCTCCAGGCATCTACAGGAGGG 0: 1
1: 0
2: 0
3: 11
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017026975 Original CRISPR CCCTCCAGGCATCTACAGGA GGG Intronic
905104886 1:35558351-35558373 CCCTGCCGGCATCCACAGGCTGG + Intronic
905732755 1:40307732-40307754 CCCCCCAGGCATCAACGGCAAGG - Exonic
908323966 1:63005451-63005473 ACCTCCAAGCATCTGCAGGTGGG + Intergenic
909344893 1:74573195-74573217 CCCTCCAGGCATAGAAAGGGGGG - Exonic
911083851 1:93959827-93959849 CCCCCCAGGCAGCTACAGATTGG + Intergenic
912039427 1:105368925-105368947 CCAGCCAGGCAGCTAGAGGAGGG - Intergenic
914513071 1:148351771-148351793 CCCTCCAGACATGTCCAGGATGG - Intergenic
915328338 1:155092783-155092805 CAGTCCAGGCACCCACAGGAGGG + Intergenic
918386117 1:184009983-184010005 ACCTCCAGGAATCTACAGCATGG - Intronic
919083302 1:192891650-192891672 CCCAGCAGGCACCCACAGGAGGG + Intergenic
920227021 1:204446517-204446539 CCCTCAGGGCATCCGCAGGAGGG - Intronic
1063972220 10:11389149-11389171 CCCTGCAGGCAGCTGCATGATGG - Intergenic
1067137561 10:43624717-43624739 CCCCCCAGGTAGCTTCAGGATGG - Intergenic
1067739427 10:48883226-48883248 CCCTCCAGGCACATGCAGGAGGG - Intronic
1068950290 10:62769894-62769916 CCCACCAGTCTTCTCCAGGATGG + Intergenic
1074751270 10:116589611-116589633 ACTTCCAGGCATCCCCAGGATGG - Intergenic
1075266297 10:121001949-121001971 ACCTCGAGCCATCTACAGGGTGG + Intergenic
1076193260 10:128497902-128497924 CCCCACAGGCATCTCCAGGTGGG + Intergenic
1076876061 10:133216187-133216209 CACTCCAGGCATCGTCAGAACGG - Intronic
1078527480 11:12111391-12111413 CCAGCCAGGCACCTACAGGGTGG - Intronic
1083228207 11:61297983-61298005 CACTCCAGGCCTCTGCACGAAGG - Intergenic
1083734451 11:64671499-64671521 CCCCCCACGCATCTTCTGGAAGG + Intronic
1084510014 11:69597495-69597517 CCCTCCTGGCACCTTCAGTATGG - Intergenic
1087282576 11:96228272-96228294 CCCTCCAGCCATCACCAGGCTGG + Intronic
1094198325 12:27772843-27772865 CCCTCGAGACATAAACAGGAAGG + Intergenic
1100710498 12:97251162-97251184 GCCTCCAGCCAACTACAGGAGGG - Intergenic
1101336685 12:103802918-103802940 CCATCCAGGCATTCAGAGGAGGG + Intronic
1101417279 12:104519456-104519478 GCCTCGAGGCAGCCACAGGATGG + Intronic
1102481550 12:113227236-113227258 CCCACCAAGCATCCACAGGCAGG - Intronic
1102890591 12:116555803-116555825 CGCTCCTGGCATCTAGTGGATGG - Intergenic
1106699216 13:32211083-32211105 CCTTTCAGGAATCTACATGAAGG - Intronic
1108455593 13:50610580-50610602 CCCTCCAGGAAAGTCCAGGAGGG + Intronic
1108862744 13:54882314-54882336 CTGTCCAGGCAGTTACAGGATGG + Intergenic
1109892569 13:68634874-68634896 CCCCCCAGGAAACAACAGGATGG - Intergenic
1110478635 13:75947665-75947687 CCGTCCAGGGAACTACAGGCAGG - Intergenic
1112008510 13:95274616-95274638 CCCTTCAGGCTCCTACAGGGGGG + Intronic
1114254295 14:20988693-20988715 CCATGCATTCATCTACAGGAAGG + Intergenic
1114853535 14:26409830-26409852 CCTTCCTGTCATCTACATGAGGG + Intergenic
1121322181 14:92998373-92998395 CACCCCAGGCATCAGCAGGAGGG - Intronic
1123007804 14:105332806-105332828 CCCTCCAGGGAGTTTCAGGAAGG - Intronic
1124183821 15:27503137-27503159 GCCTCTAGGCACCTTCAGGATGG - Intronic
1125537211 15:40448498-40448520 CCATCCTGGCATCTACACCAAGG - Intronic
1125598170 15:40900642-40900664 CAATCCAGGCATCTACAAGCTGG - Exonic
1126869468 15:52972061-52972083 CTCCCCAGGGATCTCCAGGAAGG + Intergenic
1128454347 15:67824142-67824164 CCCTCCAGCCACCTCCAGGAGGG + Intronic
1130167844 15:81481661-81481683 CCCTCCAGGAGTTTTCAGGAAGG + Intergenic
1130648199 15:85746780-85746802 CCCTCCTGGGATTTGCAGGAGGG + Intronic
1132219991 15:100098227-100098249 CCCTCCAGGTCACTACTGGATGG - Intronic
1132423918 15:101698005-101698027 TCCCCCAGCCTTCTACAGGAAGG + Intronic
1137766729 16:50983326-50983348 CACTCCAGTCAGCTTCAGGAGGG - Intergenic
1139973711 16:70792285-70792307 CCCTCCTTTCATCTACAGGTTGG + Intronic
1143758013 17:9080610-9080632 GCCTCCAGGTAGCTTCAGGATGG + Intronic
1146523682 17:33547607-33547629 CACTCTAGGCTTCTGCAGGATGG - Intronic
1147544206 17:41387588-41387610 GCCTCCAGGCATCTTGAGTATGG + Intronic
1148579351 17:48733101-48733123 CCCGCCAGACACCTCCAGGAAGG + Intergenic
1151604781 17:75129516-75129538 CCCTCCAGGGCTCTGGAGGATGG + Exonic
1152219059 17:79050934-79050956 CCCTCCAGGCACCTCTGGGAAGG - Intergenic
1152703846 17:81833048-81833070 CCCGCCCGGCACCTGCAGGAGGG - Intronic
1159895622 18:73993024-73993046 CCCGTCAGGCATCTACATGCTGG - Intergenic
1160080019 18:75717499-75717521 CACTCCAAACATCCACAGGATGG + Intergenic
1160537735 18:79603983-79604005 CCCGCCTGGCACCTCCAGGATGG + Intergenic
1160608053 18:80066969-80066991 CCCTCCAGGCAGGCAGAGGAGGG + Intronic
1161067190 19:2244445-2244467 GCCTCCATGCCTCTACAGAAAGG + Intronic
1162795498 19:13085375-13085397 CCTTCCAAGCAACCACAGGACGG - Intronic
1163439495 19:17314547-17314569 GCCTCCAGGGAGGTACAGGAGGG + Intronic
1164860969 19:31561979-31562001 CACTCCAGGTAGCAACAGGACGG - Intergenic
1165383925 19:35499510-35499532 CCAACCAGGCATCCACAGGCCGG + Intronic
1165659769 19:37567065-37567087 CCATGCAGGTATCTAGAGGAAGG - Intronic
925004297 2:429147-429169 CCCACCAGGCCTCAACAGTAGGG - Intergenic
925700847 2:6636233-6636255 GCCTCCTGGCATCTGGAGGATGG + Intergenic
926519954 2:13897918-13897940 CCATTCTGGCATCTGCAGGAGGG - Intergenic
929863820 2:45700951-45700973 CCTCCAAGGCATCTAAAGGAGGG - Intronic
932918533 2:75883390-75883412 ACTTCCAGGATTCTACAGGATGG + Intergenic
934863494 2:97784944-97784966 CCCTACAGACATCAACATGATGG + Intronic
937453527 2:122022346-122022368 CAGACCAGGCATCCACAGGAGGG - Intergenic
939575142 2:143886837-143886859 GCCTCCAGGTAGCTTCAGGATGG + Intergenic
942398222 2:175574551-175574573 CCTTCCAGGCATGTGCAGGGAGG - Intergenic
946179824 2:217942607-217942629 CACCCCAGGCAGCTTCAGGAGGG + Intronic
946308665 2:218871054-218871076 CCCTACCAGCATCTGCAGGAAGG + Exonic
946566353 2:220970092-220970114 CAGTGCAGTCATCTACAGGATGG + Intergenic
947626249 2:231621112-231621134 AGCCCCAGGCATTTACAGGAGGG + Intergenic
948109196 2:235440674-235440696 CCCACCAGGCATCTTCCTGAGGG - Intergenic
948675479 2:239594288-239594310 CCCTCCAGGAATCTGCCAGATGG - Intergenic
1168957119 20:1841923-1841945 CCCTGGAGGGATCTGCAGGATGG + Intergenic
1171198833 20:23224924-23224946 CCTTCCAGACCTCTCCAGGATGG - Intergenic
1172163780 20:32886421-32886443 CTCTCCAGGGCTCTACAGAAAGG + Intronic
1172357912 20:34292493-34292515 CCTTCCAGGCATACACTGGAGGG + Exonic
1172437730 20:34942010-34942032 TCCTCCAGGCATATACACCAGGG - Intronic
1172827171 20:37799279-37799301 CCTTCTCGACATCTACAGGATGG + Intronic
1175485410 20:59342499-59342521 CCCTCACGGCATCCCCAGGAGGG - Intergenic
1175594615 20:60220981-60221003 CCTTCGGGGCATCTACAGGCTGG + Intergenic
1177766263 21:25460815-25460837 CCCACCATCCATCAACAGGATGG + Intergenic
1180515122 22:16132858-16132880 CCCTCCAGGCCTTGACAGGGCGG + Intergenic
1180610268 22:17091986-17092008 GCCTCTAGGCAGCTTCAGGATGG + Intronic
1181983386 22:26782213-26782235 CCCTCCAGGGATCAGCAGGTGGG - Intergenic
1182886777 22:33780455-33780477 CACTCCAGGCAGCTGGAGGATGG + Intronic
1184983600 22:48114172-48114194 CCCTCCATGGATCAGCAGGAAGG - Intergenic
1185095349 22:48803367-48803389 CCCTCCAGGCATCCAAAGGCTGG + Intronic
1185095667 22:48804763-48804785 CACTCCGGGCACCTTCAGGAAGG + Intronic
949821584 3:8121819-8121841 CCCTCCAAGAGTTTACAGGAGGG + Intergenic
953757999 3:45664489-45664511 TCCTACAGGAACCTACAGGAGGG + Intronic
956706603 3:72004486-72004508 TCCTCCAGCCACCTACAGCAGGG + Intergenic
959153041 3:102630456-102630478 CCATCCAGGCACCTCCAAGAAGG - Intergenic
960034935 3:113092887-113092909 TCATCCAGACATCTATAGGAAGG - Intergenic
960054735 3:113269081-113269103 GCCTCCAGGCACACACAGGAAGG + Intronic
960850852 3:122052468-122052490 TCCCCCAGGCATCTAGAGTATGG + Intergenic
961586144 3:127927183-127927205 CCCAGCAGACATCTACAGGTAGG + Intronic
962409594 3:135129455-135129477 CCCTCCATCCACCTACAGCAAGG + Intronic
962708687 3:138068054-138068076 CCCTCCAGGCTTCTGCAGATAGG - Intronic
963574395 3:147041640-147041662 CCTTCCAGGCTTTTACAGAACGG - Intergenic
965478820 3:169191066-169191088 CCTTCCAGGAATCTGCAGTAGGG - Intronic
966928258 3:184659445-184659467 CCCCCCAGGCGGCTGCAGGAAGG - Intronic
968980035 4:3842603-3842625 GCCCCTAGGCAGCTACAGGACGG + Intergenic
969637269 4:8376659-8376681 CCTTCCTGGCACCGACAGGACGG - Intronic
969671804 4:8593810-8593832 AAATCCAGGCATCAACAGGACGG - Intronic
976387664 4:84480186-84480208 CCCTCCCTGCCTCTGCAGGAAGG - Intergenic
977572956 4:98648755-98648777 CCCTCCAGGGAGCAACGGGAAGG + Intronic
980943934 4:139301363-139301385 CCCTCCCGGCCTCCACAGGCAGG + Intronic
986064069 5:4218807-4218829 CCCTCCAGCCCTTCACAGGAGGG + Intergenic
986965642 5:13267522-13267544 CCATTCTGGCATCTAGAGGAAGG + Intergenic
987301985 5:16605467-16605489 ATCTCCAGGCATCTAGAGAATGG + Intronic
993025205 5:82637346-82637368 CCCTCCATCCATCTACAGCTTGG + Intergenic
993391034 5:87319681-87319703 ACCTCCAGGCCTGTACTGGAGGG + Intronic
995077031 5:107997468-107997490 CCCTCCAGGCATCTTAATGAGGG + Intronic
996623377 5:125538118-125538140 GCCTCCAGGTAGCTTCAGGATGG - Intergenic
1000107192 5:158071283-158071305 CACTCCAGGCTCCAACAGGAAGG - Intergenic
1002931203 6:1636567-1636589 CCTTCCAGGCACCTTCAGGACGG - Intronic
1003573270 6:7269826-7269848 CCCTCCAGGCACCCACAGTTAGG - Intronic
1003885895 6:10521121-10521143 CCCTCCAGGACTCTAGAGGCAGG + Intronic
1006907823 6:37544990-37545012 ACCTTCAGGCACCTCCAGGAAGG + Intergenic
1007198049 6:40080054-40080076 CCCTCCATGCCTATGCAGGAAGG - Intergenic
1009285342 6:61809197-61809219 CTCTGCTGCCATCTACAGGAAGG - Intronic
1012292865 6:97480909-97480931 GCCTCCAGGCATCCAAAGCATGG + Intergenic
1016567356 6:145471569-145471591 CACTCCAGGCAGCTGCAGCATGG + Intergenic
1017026975 6:150189939-150189961 CCCTCCAGGCATCTACAGGAGGG + Intronic
1017583540 6:155894475-155894497 TCCTACAGGCATCTACAGTAAGG + Intergenic
1018573384 6:165233657-165233679 CCCTACAGGCAGCCACAGAAAGG + Intergenic
1019345059 7:525610-525632 CCCTCCTGGCCTCTGGAGGAGGG + Intergenic
1019943291 7:4308047-4308069 CACTCCAGGCAAATGCAGGAGGG - Intergenic
1023188505 7:37555274-37555296 CCATCCTGGCATCTAAAGGATGG + Intergenic
1023452026 7:40296704-40296726 CCCTAGAGGCCTATACAGGAAGG - Intronic
1024300320 7:47882600-47882622 CCCTTCAAGCATCTGAAGGAAGG + Intronic
1032326825 7:130936605-130936627 CCCGCAAGGCCTCTTCAGGATGG + Intergenic
1033477689 7:141706566-141706588 CTCTCCAGGCAGCTAGAGGCTGG - Intergenic
1034541641 7:151762247-151762269 CCCTACACGCATCTCCAGGGTGG + Intronic
1034969924 7:155412629-155412651 CCCTCCAGGCACCTCCTGCATGG - Intergenic
1036815909 8:11902707-11902729 CCCTCCAGTCACAGACAGGAAGG - Intergenic
1037017839 8:13930686-13930708 TCCTCCAGCCAACTACAGGCTGG - Intergenic
1037512101 8:19593923-19593945 CCCTCTAGGCTGCTTCAGGATGG + Intronic
1039845639 8:41323663-41323685 ACCTCTAGGCATCTCCAGGGAGG - Intergenic
1039908759 8:41807811-41807833 CTCTCCAAGCATCTACAAGGGGG + Intronic
1042489006 8:69377966-69377988 ACCTCCAGGTAGCTTCAGGATGG - Intergenic
1043940486 8:86190460-86190482 GCCTCCAGGCATGTAATGGAAGG + Intergenic
1044820281 8:96151534-96151556 CCCTCCAGGCATGGGCAGCATGG - Intronic
1049236051 8:141512996-141513018 CCCTCCAGGCACCTGTAGGCAGG - Intergenic
1052863431 9:33450846-33450868 CCCTCCAGGCCTCTATAGGCTGG + Intergenic
1056207586 9:84335148-84335170 GACTCCAGGCATCTTCATGAAGG - Intronic
1056999321 9:91492958-91492980 CCCACAAGGCATCTTCAGGGAGG + Intergenic
1062511864 9:136910676-136910698 CCATCTGGGCAGCTACAGGAGGG + Intronic
1062522689 9:136964848-136964870 CCCCCAAGGCGGCTACAGGAAGG + Intergenic
1185610482 X:1391538-1391560 CCTGCCAGGCATCCACCGGAAGG + Intronic
1186778679 X:12891551-12891573 TGCTCCTGGCATCTACTGGAAGG + Intergenic
1189056435 X:37704188-37704210 CCCTACAATCAGCTACAGGAGGG - Intronic
1189510612 X:41657869-41657891 GCCTCTAGGCAGCTTCAGGATGG + Intronic
1195382956 X:104288441-104288463 GCCTCTAGGCAGCTTCAGGATGG + Intergenic
1197023130 X:121715865-121715887 TCCTACAGGCATGTTCAGGATGG - Intergenic