ID: 1017029009

View in Genome Browser
Species Human (GRCh38)
Location 6:150204692-150204714
Sequence CAACCCGTGAGAGCTGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 177}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017029009_1017029015 7 Left 1017029009 6:150204692-150204714 CCTGCCCCAGCTCTCACGGGTTG 0: 1
1: 0
2: 2
3: 32
4: 177
Right 1017029015 6:150204722-150204744 CAGAGATGAAACTGAAACCTGGG No data
1017029009_1017029014 6 Left 1017029009 6:150204692-150204714 CCTGCCCCAGCTCTCACGGGTTG 0: 1
1: 0
2: 2
3: 32
4: 177
Right 1017029014 6:150204721-150204743 GCAGAGATGAAACTGAAACCTGG 0: 1
1: 0
2: 5
3: 43
4: 408

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017029009 Original CRISPR CAACCCGTGAGAGCTGGGGC AGG (reversed) Intronic
900628147 1:3618898-3618920 CAACCTGGGGGAGCTGGTGCCGG + Intergenic
901217344 1:7562135-7562157 CAACCCGTGAATCCTGGTGCGGG - Intronic
901643508 1:10704862-10704884 CAGCCCGTGAAGGCTGGGCCAGG + Intronic
904042503 1:27592799-27592821 TAACCTGTGAGGGCTGGGGGTGG + Intronic
905475662 1:38225922-38225944 CAACCAGTCAGAGGTGGAGCTGG + Intergenic
906416194 1:45622734-45622756 AATCCGGTGAGAGCCGGGGCCGG - Exonic
915268940 1:154738621-154738643 CAACCCGTCCGGGCTGGAGCAGG + Intronic
919806529 1:201383997-201384019 CAGCCTGTGAGAGCTGGGGAAGG - Intronic
920116675 1:203626600-203626622 CAACAAGTGAGAGCAAGGGCGGG + Exonic
920601967 1:207335763-207335785 CATCCCGTGTGTGATGGGGCTGG + Intronic
1062800849 10:379206-379228 CAACCCCTGACAGCTGCTGCTGG + Intronic
1063176394 10:3554453-3554475 CAGCCCGTGAGTGCTGGAGCCGG + Intergenic
1065371089 10:24987186-24987208 AATCCAGTGAGAGCTGGAGCTGG - Intronic
1066250053 10:33624591-33624613 CAACCCTCCAGATCTGGGGCCGG - Intergenic
1067797739 10:49332991-49333013 CAAGCGGTGGGAGTTGGGGCTGG - Intergenic
1070033844 10:72702635-72702657 CTACCTGTGAGAGCTGAGGAAGG + Intronic
1070539822 10:77408035-77408057 CCACCCAGGACAGCTGGGGCAGG + Intronic
1070678838 10:78434654-78434676 CAAGAGGTGAGAGCTGGGGATGG + Intergenic
1071224295 10:83509795-83509817 CACCTCGTGAGTGCTGGGGGTGG - Intergenic
1072537480 10:96374642-96374664 CCAGCTGTGTGAGCTGGGGCAGG - Intronic
1073329520 10:102661317-102661339 CAACATGAAAGAGCTGGGGCCGG - Intergenic
1076315517 10:129537828-129537850 CAAACCATGGGAGCTGGGGCTGG + Intronic
1077088153 11:765061-765083 CAGCCCATCACAGCTGGGGCAGG - Intergenic
1077384915 11:2264250-2264272 CTACCCCTCAGAGCTGGGGCAGG - Intergenic
1077563677 11:3282504-3282526 CAAGCAGTGAGAGATGGAGCTGG - Intergenic
1077569567 11:3328321-3328343 CAAGCAGTGAGAGATGGAGCTGG - Intergenic
1078619077 11:12891339-12891361 CATCAGGTGAGAGCAGGGGCTGG + Intronic
1079252244 11:18794754-18794776 CCACATGTGACAGCTGGGGCTGG - Intergenic
1081613745 11:44578654-44578676 CATCCACTGAGAGCTGGGGCAGG - Intronic
1083186812 11:61022438-61022460 CTCCCTGTGTGAGCTGGGGCGGG - Intergenic
1083344437 11:61979490-61979512 CAACGCTTGTGAGATGGGGCAGG - Intergenic
1083627065 11:64077313-64077335 CAGCCCCTGAGAGATGGTGCTGG - Intronic
1084320328 11:68370010-68370032 AGGCCCGTGAGAGCTGGGGCAGG + Intronic
1084344753 11:68539247-68539269 CAATCTCTGAGAGCTTGGGCAGG + Intronic
1084798545 11:71526009-71526031 CAACCCATGAGAGCAGCTGCAGG + Intergenic
1084803641 11:71564270-71564292 CAACCCATGAGAGCAGCTGCAGG + Intronic
1085739250 11:79064975-79064997 CACCCTGCGGGAGCTGGGGCTGG - Exonic
1086877309 11:92112190-92112212 CACCCCATCAGAGCTGGTGCTGG + Intergenic
1087458397 11:98416381-98416403 CTACTCGTGAGAGCTGAGGCAGG + Intergenic
1090202483 11:124866297-124866319 CACCCCGGCAGAGCTGTGGCGGG + Intronic
1091095827 11:132821334-132821356 CATCCAGGGAGAGCTGTGGCTGG - Intronic
1091703474 12:2679039-2679061 CACACCGTGAGGGCGGGGGCTGG - Intronic
1092255708 12:6925915-6925937 CAAGCCGGAAGAGCTGGAGCTGG - Intronic
1094756694 12:33478054-33478076 CAATCAGAGAGAGCTGGGGCAGG + Intergenic
1101469583 12:104984133-104984155 GAACCCATGAGGGCAGGGGCTGG - Intergenic
1103024650 12:117563772-117563794 CCACCCATGAGAGAGGGGGCTGG - Intronic
1103745612 12:123121150-123121172 GAACCGGTGAGAGCTTGGCCAGG - Intronic
1103827918 12:123754945-123754967 CTACCCATGAGTGCTGTGGCAGG - Intronic
1108472301 13:50779658-50779680 CAATCCGTGAGACCTGGGAGAGG - Intronic
1112710904 13:102128030-102128052 CTCTCTGTGAGAGCTGGGGCAGG - Intronic
1113958510 13:114112517-114112539 CACCCCTACAGAGCTGGGGCTGG - Intronic
1113984682 13:114304157-114304179 CACCCCTTCAGTGCTGGGGCAGG + Intronic
1119116263 14:72024545-72024567 CAACCCGTGAGTGCAAGAGCTGG - Intronic
1122116632 14:99530809-99530831 CAGCAGGTGAGCGCTGGGGCGGG + Intronic
1122252979 14:100453323-100453345 CATACTGTGAGAGGTGGGGCAGG - Intronic
1122830163 14:104392062-104392084 CCACCTGTGTGTGCTGGGGCAGG + Intergenic
1122854260 14:104552568-104552590 GCACCCGCGAGACCTGGGGCAGG + Intronic
1123955221 15:25328035-25328057 CAACTCCTGAGAGCTGGGTAGGG - Intergenic
1124114388 15:26827650-26827672 TAGCCAGTGTGAGCTGGGGCAGG - Intronic
1125492466 15:40158501-40158523 CAACCAGAGAGAGCTTGAGCAGG - Intergenic
1127287610 15:57545002-57545024 CCACCAGTCAGAGATGGGGCAGG + Intronic
1131183777 15:90258080-90258102 CAACCCTGGAGAGCTGTGGGGGG + Intronic
1131353394 15:91722046-91722068 CAACCTGTGGGGGCTGGGGTGGG - Intergenic
1131397559 15:92098421-92098443 CCTCCCCTGAGAGCTGGGGGAGG + Intronic
1132097660 15:99000011-99000033 CAAGCTGAGAGAGCTGGCGCTGG - Intronic
1132765460 16:1532160-1532182 CCACCCGGGAGAGTGGGGGCCGG + Intronic
1133232478 16:4373117-4373139 AAACCCAACAGAGCTGGGGCAGG + Intronic
1134397031 16:13874496-13874518 CAACACTTGACATCTGGGGCTGG - Intergenic
1134850489 16:17474686-17474708 GAACCCCTGGGAGCAGGGGCCGG + Intergenic
1136349777 16:29699225-29699247 CCAGCTCTGAGAGCTGGGGCGGG + Intergenic
1136453881 16:30369924-30369946 CTGCCCGTGACAGCCGGGGCTGG + Exonic
1136587823 16:31199014-31199036 CAGCTAGTGAGAGGTGGGGCAGG + Intergenic
1138228054 16:55315829-55315851 CAACCTGTGGGAGATGTGGCTGG - Intergenic
1141691494 16:85599363-85599385 CACCCCCTTAGAGCTGGGACAGG + Intergenic
1142200179 16:88757410-88757432 CAGCCTGTGAGAGCAGGGGCGGG + Intronic
1142206915 16:88787671-88787693 CAGCCAGGGAGAGGTGGGGCGGG + Intergenic
1143271473 17:5678644-5678666 CAACCTGTGAGAGCTGTGGCAGG + Intergenic
1143686236 17:8518242-8518264 CTACCTGTGGGAGCTGAGGCGGG - Intronic
1143807438 17:9440977-9440999 CAACCCCTGGGAGCTGGAGATGG - Intronic
1144445389 17:15322624-15322646 CAACCTGTGGGAGCAGGGTCTGG - Intronic
1144607810 17:16683485-16683507 GAACCCGCGAGAGCGGCGGCAGG - Intergenic
1144742107 17:17589881-17589903 CAGCTGGAGAGAGCTGGGGCTGG - Intronic
1144777458 17:17791968-17791990 CAGCAGGTGAGGGCTGGGGCAGG - Intronic
1145028483 17:19486971-19486993 CAACCTGTGACCGCTGGGTCAGG - Intergenic
1145197024 17:20902671-20902693 GAACCCGTGAGAGCAGCGGCAGG + Intergenic
1146787459 17:35732041-35732063 CGCCACGTGAGAGCTGGAGCTGG + Intronic
1148161346 17:45451876-45451898 CAAAGTGTGAGCGCTGGGGCAGG + Intronic
1149433855 17:56617018-56617040 CAACCTGGGAGAGTTGGGGTGGG + Intergenic
1150105936 17:62462526-62462548 CAACCCCTAAGAGCAGGGGCTGG + Intronic
1150392585 17:64798522-64798544 CAAAGTGTGAGTGCTGGGGCAGG + Intergenic
1150770366 17:68035861-68035883 CAAGCCGTTAGCGCTCGGGCCGG - Intronic
1151184458 17:72353036-72353058 CAACCAGTGATAGATGGGGGTGG - Intergenic
1152353126 17:79794307-79794329 CAGCCCGAATGAGCTGGGGCAGG - Exonic
1152702541 17:81826151-81826173 CAATCAGTGGGATCTGGGGCAGG - Exonic
1154428718 18:14291946-14291968 CAGCCCGTGAGAGCAGCTGCAGG - Intergenic
1157684674 18:49632465-49632487 CCACCTGTGAGAGCTGGGGAAGG + Intergenic
1160422187 18:78754815-78754837 CACCCCATGTGACCTGGGGCAGG - Intergenic
1160766097 19:808757-808779 CATCCCGTGAGTGCTGGGCCGGG + Exonic
1160969589 19:1761631-1761653 TTACCCGGGAGAGCTGGCGCTGG + Intronic
1163051908 19:14690432-14690454 GGACAGGTGAGAGCTGGGGCCGG - Intronic
1164399713 19:27894236-27894258 CAGCCTGTGAGAGCTGGGGAAGG - Intergenic
1164668591 19:30059954-30059976 CATCCCGGGAGAGCTGGGTCAGG - Intergenic
1167097484 19:47382102-47382124 CAGCACGTGTGAGCTGGGCCAGG + Exonic
1167534558 19:50041485-50041507 AAAGCTGTGACAGCTGGGGCTGG - Intronic
1167697647 19:51024621-51024643 CAAGCCGTGGGTGCGGGGGCTGG - Exonic
925039065 2:716324-716346 GAAGCTGTGAAAGCTGGGGCCGG + Intergenic
926803711 2:16685251-16685273 CTACCTGTGAGAGCTGAGGGAGG - Intergenic
930469378 2:51793528-51793550 CAACCTGTGAGAGCAGCTGCAGG - Intergenic
932469690 2:71945706-71945728 GAACCTGGGAGAGCTGAGGCTGG + Intergenic
932832616 2:75005712-75005734 CAATTCTTGAGAGCTGGTGCTGG - Intergenic
934492456 2:94770949-94770971 CAGCCCATGAGAGCAGTGGCAGG + Intergenic
935782129 2:106517591-106517613 CAACCCCAGAGAACTGGGGAAGG - Intergenic
936427604 2:112434321-112434343 GACCCCCTGACAGCTGGGGCTGG - Intronic
940639037 2:156329212-156329234 AGTCCCGGGAGAGCTGGGGCTGG + Intronic
944613158 2:201431806-201431828 CAACCAGTAAGTGGTGGGGCTGG - Intronic
946128595 2:217586480-217586502 CATCCTGTGAGAGCTGAGTCAGG - Intronic
948689888 2:239695324-239695346 CAGACCATGTGAGCTGGGGCAGG - Intergenic
948902735 2:240964559-240964581 CCACCTGTGGGAGCTGGAGCAGG + Intronic
949005611 2:241645299-241645321 CAGCCCGTGAGGCCGGGGGCAGG + Intronic
1169350458 20:4864029-4864051 CCACACGTGAGAGGTGGTGCTGG + Intronic
1171392520 20:24810888-24810910 CATCCTATGGGAGCTGGGGCAGG + Intergenic
1171483186 20:25468823-25468845 CCACCAGTGAGAGTTGGGACAGG - Intronic
1171483316 20:25469266-25469288 CCACCAGTGAGAGTTGGGACAGG - Intronic
1171516926 20:25745701-25745723 AAAGCCGTGAGTGCTGGAGCTGG + Intergenic
1172110979 20:32544718-32544740 CAAGCCGTGTGACCTGGGGCTGG - Intronic
1173450485 20:43159253-43159275 CATGCCATGAGAGCTGGGGGTGG + Intronic
1173666968 20:44769855-44769877 CAGCCACTGAGAGGTGGGGCTGG - Intronic
1174360048 20:50023313-50023335 CAACAGGTGAGGGCTGGGGCAGG - Intergenic
1174451722 20:50624758-50624780 CCTCACGTGAGGGCTGGGGCCGG - Intronic
1176374627 21:6080886-6080908 GACCCCCTGACAGCTGGGGCTGG + Intergenic
1176413090 21:6459285-6459307 GGACCTGTGAGAGCTGGGGCAGG - Intergenic
1178889302 21:36508039-36508061 CAGCCAGGGAGAGCTGGGGAAGG + Intronic
1179416090 21:41199741-41199763 CTGCCAGTGAGAGCTGGGGCTGG - Intronic
1179688585 21:43067607-43067629 GGACCTGTGAGAGCTGGGGCAGG - Intronic
1179748848 21:43457359-43457381 GACCCCCTGACAGCTGGGGCTGG - Intergenic
1180219088 21:46346604-46346626 CATCCCGTGGAAGCAGGGGCAGG - Intronic
1180904807 22:19401972-19401994 GAACCCCTGGGAGCTGGGGCGGG - Intronic
1181043523 22:20204042-20204064 AAACCCATGAGAGCTGTGGCAGG - Intergenic
1181269496 22:21650948-21650970 CAGCCCATAGGAGCTGGGGCTGG - Intergenic
1181805101 22:25369834-25369856 AGGCCCGTGAGAGCCGGGGCAGG - Intronic
1182360694 22:29744761-29744783 GAACCTGAGAGGGCTGGGGCCGG - Intronic
1182866810 22:33611282-33611304 CAACCCATGAGAGCAGCTGCAGG + Intronic
1184168241 22:42743302-42743324 AAAGCTGTGAGGGCTGGGGCAGG + Intergenic
1184489396 22:44800475-44800497 TACCCCTTGAGAGCTGGGACTGG - Intronic
950436478 3:12983433-12983455 AACCCAGTGAGAGGTGGGGCTGG - Intronic
950628492 3:14265912-14265934 CAACCTGTTAGAACTGGAGCTGG + Intergenic
953759975 3:45678939-45678961 AAACCCATGAACGCTGGGGCTGG + Exonic
954091148 3:48285338-48285360 CAGCTCAAGAGAGCTGGGGCTGG - Intronic
954645660 3:52130124-52130146 CAACGCGTGAGAGGTGGTGGTGG - Intronic
959838914 3:110951505-110951527 CAACCTGTGAGAGCAGCTGCAGG + Intergenic
960971325 3:123142109-123142131 GGACCAGGGAGAGCTGGGGCAGG - Intronic
962829658 3:139128881-139128903 CTGCCTGGGAGAGCTGGGGCGGG + Intronic
968731408 4:2270974-2270996 CAACCCCTGGCAGCTGGGGCTGG - Intronic
968927189 4:3555730-3555752 CGGCCTCTGAGAGCTGGGGCGGG + Intergenic
968955043 4:3714079-3714101 CCAGCAGTGAGAGCTGAGGCCGG + Intergenic
969388096 4:6870008-6870030 CACCCTGGGCGAGCTGGGGCAGG + Intronic
969595245 4:8145017-8145039 CCAGCCGTGTGACCTGGGGCGGG + Intronic
975351522 4:73352406-73352428 CAACTAGTGAGAGATGGAGCTGG + Intergenic
982702324 4:158671353-158671375 AAACCAGTGAGGGGTGGGGCGGG + Intronic
985538205 5:475949-475971 CGAGCCGGGAGGGCTGGGGCTGG + Intronic
985696959 5:1346073-1346095 CAACCCCTGGAAGCTGGGCCAGG + Intergenic
987298382 5:16574538-16574560 GAACCAGTGAGAGCTTGGGTTGG - Intronic
987672065 5:21022760-21022782 CAGCTGGTGAGAGCTGTGGCTGG - Intergenic
989606222 5:43246671-43246693 CAAACAATGAGAGCTAGGGCAGG - Intronic
996815071 5:127565517-127565539 CTCCCCGTGTGAGGTGGGGCTGG + Intergenic
997266555 5:132498190-132498212 CAGCCCAGAAGAGCTGGGGCTGG + Intergenic
997284071 5:132665812-132665834 CCACCCGTGAGTGCTGGGAAGGG - Intergenic
997870411 5:137501020-137501042 CAACAGGTTAGTGCTGGGGCCGG - Intronic
998294293 5:140952169-140952191 CAACCCATGAGAGCAGCTGCAGG - Intronic
998463369 5:142325182-142325204 TAACCCGTGATTGCTGGGACTGG + Intronic
999720772 5:154397841-154397863 GAACCCGAGAGGGCAGGGGCTGG - Intronic
1000463200 5:161547299-161547321 CAACCCGTTGGATTTGGGGCGGG + Intronic
1002055577 5:176596475-176596497 CACCCCCTGAGAGCTGGGGCAGG - Exonic
1005680893 6:28207346-28207368 AAAGCCGTGAGTGCGGGGGCGGG - Intergenic
1006512270 6:34528123-34528145 AACCCCATGAGAGCAGGGGCTGG + Intronic
1007496495 6:42263398-42263420 GAACCCCTGAGAGCTGGGCTTGG + Exonic
1011411182 6:87068032-87068054 CCACCTGTGAGAGCTTGGGCAGG + Intergenic
1017029009 6:150204692-150204714 CAACCCGTGAGAGCTGGGGCAGG - Intronic
1017990002 6:159478428-159478450 CAACCAGTTAGAGTAGGGGCGGG - Intergenic
1019555344 7:1626703-1626725 GAACCAGGGAGAGCTGGGGGTGG - Intergenic
1022481416 7:30745523-30745545 GAACCCGTGAGACCTGGCCCTGG - Intronic
1024766712 7:52668838-52668860 CAACACGTGGCACCTGGGGCTGG - Intergenic
1026007550 7:66612048-66612070 CAACTCGTGAAGGCTGAGGCAGG - Intergenic
1029707611 7:102284021-102284043 CCACCCCTGGGAGCTGGGGCTGG + Intergenic
1032035096 7:128515731-128515753 CAACCCCTAAGAGCAGGGGCTGG + Intergenic
1032245322 7:130206325-130206347 AAGCTCGCGAGAGCTGGGGCTGG - Intronic
1034694760 7:153043661-153043683 CAGCCTGTGACATCTGGGGCTGG - Intergenic
1039064301 8:33595865-33595887 CAACCCGTGTGACCTTGGCCAGG + Intronic
1039565658 8:38550859-38550881 TAACACGTAAGAGCTGGCGCTGG - Intergenic
1040580311 8:48693586-48693608 CAAGCCCTGTGAGCTGGGGTGGG + Intergenic
1044700253 8:94959159-94959181 TAACCTGTGAGTGATGGGGCTGG + Intronic
1048301334 8:133253369-133253391 CAACCAGGGAGAGGTGGGGCCGG - Intronic
1048744499 8:137599150-137599172 CACCCTCTGAGAGATGGGGCTGG - Intergenic
1048980566 8:139701756-139701778 AGACCTGTGGGAGCTGGGGCAGG - Intronic
1049239857 8:141531830-141531852 CAGCCCCTCAGAGCAGGGGCAGG + Intergenic
1049248885 8:141577672-141577694 CAGCCCCTGAGAGGTGGGGTTGG + Intergenic
1053353502 9:37428597-37428619 CACGCTGTGAGAGCCGGGGCGGG - Intronic
1053665555 9:40315006-40315028 CAGCCCATGAGAGCTGCGGCAGG - Intronic
1053915136 9:42940053-42940075 CAGCCCATGAGAGCTGTGGCAGG - Intergenic
1054376708 9:64455036-64455058 CAGCCCATGAGAGCTGCGGCAGG - Intergenic
1054519059 9:66061278-66061300 CAGCCCATGAGAGCTGCGGCAGG + Intergenic
1056848249 9:90058826-90058848 GAACCCCTGATAGCTGCGGCTGG - Intergenic
1057746914 9:97759827-97759849 CCACCTGTGACAGCTGGGTCAGG - Intergenic
1058040357 9:100295517-100295539 TAAGCAGTGAGGGCTGGGGCAGG + Intronic
1060482084 9:124022603-124022625 CAATCCCAGAGACCTGGGGCTGG - Intronic
1061495840 9:130973744-130973766 GCACCCATGACAGCTGGGGCAGG - Intergenic
1062479485 9:136744772-136744794 CAACCTCTGAGAGCTGGGGAGGG + Intronic
1188551370 X:31368455-31368477 CAACCAGTGGGAGCAGGAGCAGG + Intronic
1191735466 X:64384265-64384287 CAACCTGTGAGAGCAGCTGCAGG - Intronic
1195197844 X:102516779-102516801 CAATCAGAGAGGGCTGGGGCGGG - Exonic
1197726668 X:129781288-129781310 CAGGACCTGAGAGCTGGGGCAGG - Intronic
1201398038 Y:13570842-13570864 CACCCTGTGAGAGCTGACGCAGG + Intergenic