ID: 1017031257

View in Genome Browser
Species Human (GRCh38)
Location 6:150224871-150224893
Sequence CCTTACTACCACACTACTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 157}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017031257_1017031262 -9 Left 1017031257 6:150224871-150224893 CCTTAAGTAGTGTGGTAGTAAGG 0: 1
1: 0
2: 1
3: 30
4: 157
Right 1017031262 6:150224885-150224907 GTAGTAAGGTGTGAGGAGAGGGG 0: 1
1: 0
2: 7
3: 50
4: 475
1017031257_1017031261 -10 Left 1017031257 6:150224871-150224893 CCTTAAGTAGTGTGGTAGTAAGG 0: 1
1: 0
2: 1
3: 30
4: 157
Right 1017031261 6:150224884-150224906 GGTAGTAAGGTGTGAGGAGAGGG 0: 1
1: 1
2: 4
3: 54
4: 408

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017031257 Original CRISPR CCTTACTACCACACTACTTA AGG (reversed) Intronic
902901853 1:19522804-19522826 ACTTACAACCACAATACTTTGGG + Intergenic
903309768 1:22445463-22445485 CCTTACCACCACATCACTAAAGG + Intergenic
903313961 1:22486182-22486204 CCCTACTACCACATCACTAAAGG - Intronic
906885882 1:49647919-49647941 TCTTACCACCACATTACTAAAGG + Intronic
907090997 1:51725548-51725570 CCTTACCACCACATTACTAAAGG - Intronic
907813757 1:57898097-57898119 CCCTACTGCCCCTCTACTTAGGG + Intronic
910905562 1:92174013-92174035 GCTTAGTACCAAAATACTTAAGG + Intronic
911591223 1:99750271-99750293 CCTTACCACCACATTATTAAAGG + Intronic
912970364 1:114275666-114275688 CCTTGCCACCACAATACTAAAGG + Intergenic
917782558 1:178413487-178413509 CCTTACTACTACATGACTAAAGG + Intronic
918352262 1:183669632-183669654 CCTTACCACTACATTACTAAAGG - Intronic
923023418 1:230185402-230185424 CCTTAACACCACACAACTAAAGG - Intronic
923993565 1:239466551-239466573 CCTAACTCCCACATTATTTAAGG + Intronic
1063279860 10:4616163-4616185 CCTTATTAACAAACCACTTAAGG - Intergenic
1064701555 10:18027125-18027147 CCTTCTTACCACATTACTAATGG - Intronic
1064705288 10:18066693-18066715 CCTCACCACCACAATACTAACGG - Intergenic
1067451313 10:46383804-46383826 CCCTACTACCACAGTCCTCAAGG - Intronic
1067585929 10:47475952-47475974 CCCTACTACCACAGTCCTCAAGG + Intronic
1067917963 10:50421299-50421321 CATTACTACCACCATACCTAGGG + Intronic
1068062623 10:52088028-52088050 CCATACTCCCACCCTACCTAGGG + Intronic
1069647261 10:70009694-70009716 CCTTACCACCACATCACTGAAGG + Intergenic
1071080796 10:81807459-81807481 CCCTACCACCACATTACTAAAGG + Intergenic
1071552588 10:86578501-86578523 CCTTACCACCACAGGACTAAAGG - Intergenic
1072072358 10:91931504-91931526 ACTTACTCCCATACTACTTTTGG - Intronic
1072509349 10:96103074-96103096 CCTTACTTCCAAACAACTCAAGG + Intergenic
1074926225 10:118075115-118075137 CCATACTATCACATTACTAAAGG - Intergenic
1078591414 11:12643300-12643322 CCTTACCACCACATTACTGAAGG + Intergenic
1082020211 11:47526454-47526476 GATTAATACCACACTGCTTATGG + Intronic
1083569420 11:63749561-63749583 CCTTTCTGCCAAACTATTTAAGG + Intronic
1084993461 11:72951880-72951902 CCTTACTCCCATAAAACTTAGGG + Intronic
1090682213 11:129073133-129073155 CCTTACCATCACATTACTAACGG + Intronic
1090768662 11:129898940-129898962 CCTTACCACCACATTGCTAAAGG - Intergenic
1090842031 11:130498734-130498756 CCTTACCACCACATTAATAAAGG - Intergenic
1090947508 11:131444658-131444680 CCCCACAACCACACTTCTTAAGG - Intronic
1093224361 12:16463745-16463767 CCTTATTTTCACACTACGTAGGG - Intronic
1093697755 12:22181318-22181340 CCTTACAACCACACGAATAAAGG + Intronic
1094738079 12:33258399-33258421 CCTTACAACCAAAATGCTTATGG - Intergenic
1095609004 12:44105563-44105585 CCTTACTACCACATTAGTAAAGG - Intronic
1097456371 12:59803635-59803657 CCTTACCACCACATTACTAAAGG - Intergenic
1097718404 12:62993501-62993523 CCTTACCAACACATTACTAAAGG - Intergenic
1099199238 12:79656339-79656361 CATTACTACCACACTAGTTCAGG - Intronic
1099907130 12:88784742-88784764 CCTTACCACCACATTAATAAAGG + Intergenic
1100540905 12:95556476-95556498 CCATATTACTAAACTACTTAAGG + Intergenic
1104091640 12:125522630-125522652 ACTTGCTACCAAACTACTGAAGG + Intronic
1105729931 13:23202376-23202398 CATTGCTACCACACTAGTTTAGG - Intronic
1110214583 13:73011718-73011740 CCTTACCACCACATTACCAAAGG + Intronic
1110254832 13:73421661-73421683 TCTCACTACCACACTACCTCTGG + Intergenic
1111202205 13:84953711-84953733 CCTTACTACCATCCTACATGAGG + Intergenic
1111217062 13:85158120-85158142 CCTTACCATGACACTACTTCAGG - Intergenic
1115668625 14:35582982-35583004 CCTTACCACCATACCACTAAAGG + Intronic
1116811048 14:49540602-49540624 CCTTACCACCACATCACTTAAGG + Intergenic
1116835150 14:49763186-49763208 TCTTACTACCACACCACAGAAGG - Intergenic
1118960187 14:70522873-70522895 CCATACTGGCACACTTCTTACGG + Exonic
1120078657 14:80189203-80189225 CCTTACCATCACATTACTAAAGG + Intergenic
1125261353 15:37829103-37829125 CCTTCTTTCCAGACTACTTAGGG - Intergenic
1126730329 15:51675669-51675691 CCTGACCACCACACTAATGAAGG + Intergenic
1127162863 15:56208439-56208461 CCTTACTACCACATTACTAAAGG + Intronic
1127451055 15:59116883-59116905 CCTTGCCACTACACTTCTTAAGG + Exonic
1130309724 15:82742683-82742705 CCTTACCCCCACATTACTAAAGG + Intergenic
1130328977 15:82904793-82904815 CCTTATCACCACATTACTAAAGG + Intronic
1132022777 15:98377342-98377364 CCTTACCACCACACAGCTAAAGG + Intergenic
1132134376 15:99320398-99320420 CCTTAGTAATACACTACTTAGGG - Intronic
1135653330 16:24226077-24226099 CCTTAAACCCACACAACTTAAGG + Intergenic
1137475268 16:48802429-48802451 CCTTACCCCCACACTACTACAGG + Intergenic
1139494121 16:67303506-67303528 ACTCCCTACCACACTCCTTAGGG - Intronic
1140140122 16:72247951-72247973 CTTTGCTAACACACTACTTCAGG + Intergenic
1143717211 17:8782684-8782706 CCTTACCACCACATTACTAAAGG + Intergenic
1146415935 17:32633012-32633034 ACATACTACCAAACTACTCATGG + Intronic
1149111610 17:53038346-53038368 TCTTACAAACACATTACTTATGG + Intergenic
1149722103 17:58855464-58855486 TCTTACTACCACGTTACTAAAGG + Intronic
1149727431 17:58910605-58910627 CCTTATCACCACATTACTAAAGG - Intronic
1154090707 18:11359093-11359115 ACTTACTAACAGATTACTTAAGG + Intergenic
1154177959 18:12100080-12100102 CCTAAATCCCACACTACTCAAGG - Intronic
1157044385 18:44081543-44081565 CCTTACTGCAATATTACTTAAGG + Intergenic
1158664684 18:59421876-59421898 CCTTAGTCACAAACTACTTAAGG - Intergenic
1160056166 18:75482914-75482936 CCTTACCACCACATTACTAAAGG + Intergenic
1164815292 19:31194605-31194627 CCTTACTACCACTTTACTAAAGG + Intergenic
925784483 2:7417809-7417831 CTTTACCACCACATTACTAAAGG - Intergenic
926976100 2:18518536-18518558 GCTTACTATCCCACTACTTACGG - Intergenic
929856864 2:45644722-45644744 TCTTATTACCAAACAACTTAAGG + Intergenic
931496077 2:62808737-62808759 CCTTACCATCACATTACTCAAGG - Intronic
934637656 2:96005606-96005628 CCTTACTACGACATTACTATAGG - Intergenic
938316830 2:130335496-130335518 TCTTACTGCCACATCACTTAGGG - Intergenic
941026055 2:160457521-160457543 CCTTTCTCCCACACCATTTATGG - Intronic
941570893 2:167169089-167169111 CCTTACCACTATACTACTAAAGG - Intronic
944426544 2:199589190-199589212 CCTAACTACCTCACTAATTCTGG + Intergenic
944433073 2:199657727-199657749 CCTTACTACCATATTATTAAAGG - Intergenic
944525827 2:200618679-200618701 ACTCACTACCCAACTACTTAAGG - Intronic
1170721333 20:18882247-18882269 CCTTACCACCACATCACTAAAGG - Intergenic
1173505118 20:43580795-43580817 GCTTATTATCTCACTACTTAAGG + Intronic
1175437464 20:58963694-58963716 CCTTACCAACACATTACTAAAGG + Intergenic
1175454549 20:59102071-59102093 GCTTACCACCACAGTACTAAAGG - Intergenic
1177384054 21:20385981-20386003 CCTTACCATCACACCACTAAAGG - Intergenic
1177911591 21:27040061-27040083 TCTTAATACAACACTACTTAAGG + Intergenic
1182056892 22:27365497-27365519 GCTTACCACCACATTACTAAAGG - Intergenic
1183237849 22:36633053-36633075 CCTCACTACCTCACTTCTTCAGG + Intronic
949126604 3:452493-452515 CCTGGCTACCAAACTAATTATGG + Intergenic
949911476 3:8913009-8913031 CCTTACAAACACACTACAAATGG + Intronic
951391341 3:22107778-22107800 TATTAATACCACACTACATATGG - Intronic
952472515 3:33671262-33671284 CCTTACCAACACATTACTAAAGG + Intronic
956925287 3:73980461-73980483 CCTTCCTTCCATACCACTTATGG - Intergenic
957277790 3:78110834-78110856 CCTTACCACTACATTACTGAAGG + Intergenic
961932477 3:130548269-130548291 CCTTACCACCACATTACCAAAGG - Intergenic
962899531 3:139746931-139746953 CCTTCCTACCACATTACTAAAGG + Intergenic
963573862 3:147033775-147033797 CCTTACCACCATATTACTAAAGG + Intergenic
964608217 3:158581588-158581610 CCTTACCACTACATTACTAAAGG + Intronic
964852585 3:161110638-161110660 CCTTACCATCACATTACTAAAGG + Intronic
965694193 3:171390044-171390066 CCTGACTACCAAAGTAATTAAGG + Intronic
965940152 3:174169538-174169560 CCTTCCTACCACATTAATTGTGG - Intronic
966505223 3:180693079-180693101 CCTAACAACCACACTCCTTAAGG + Intronic
971697752 4:29928801-29928823 CCTTATTACCACATTTCTTATGG + Intergenic
974189477 4:58486224-58486246 TCTTCCTACCACATTACTAAAGG - Intergenic
976888689 4:90017113-90017135 CCTCACTACCACATTATTAAAGG + Intergenic
977111484 4:92962289-92962311 CCTTACCACCACATTACTAAAGG - Intronic
978658014 4:111089245-111089267 CCTTACTACCACATCACTAGAGG + Intergenic
979039005 4:115763011-115763033 CCTTACCACCACATTACTAAAGG + Intergenic
979824448 4:125216060-125216082 CCTCACTAGCACATTACTTATGG - Intergenic
980182734 4:129421983-129422005 TCTTACTCCCACAGTATTTAAGG - Intergenic
982403780 4:154998351-154998373 CCCTACAACCACATTACTAAAGG - Intergenic
982922057 4:161288100-161288122 CCTTACCACCACATTACTAAAGG + Intergenic
983123274 4:163915807-163915829 TCTTACTACCTGACTATTTAAGG - Intronic
983579592 4:169294040-169294062 CCATACCACCACATTACTAAAGG + Intergenic
984298151 4:177880707-177880729 CCTTACCACCACATTACCAAAGG - Intronic
987478399 5:18421009-18421031 CCTTACCACCACATGACTAAAGG + Intergenic
988648024 5:33117508-33117530 ACTTACCACCACATTACTGAAGG - Intergenic
989723978 5:44565557-44565579 CCTCACTACCACATTGCTAAAGG - Intergenic
990571344 5:57082196-57082218 CCTTCCTACCACATCACTAAAGG - Intergenic
991007512 5:61844305-61844327 CCTTACCACTACATTACTAAAGG + Intergenic
991323298 5:65401156-65401178 CCTTATCACCACATTACTAAAGG - Intronic
991542550 5:67745872-67745894 ACTTACCACCACACCACTAAAGG + Intergenic
992033411 5:72746893-72746915 TCTTACTACCACATTACGAAAGG + Intergenic
993022073 5:82604054-82604076 CCTTACCACCACATTACTAAAGG + Intergenic
993390722 5:87317300-87317322 CCATTTTACCACACTGCTTAAGG + Intronic
994541249 5:101101278-101101300 CCTGACCACCACATTACTAAAGG - Intergenic
996025087 5:118637034-118637056 CCTTACCACCACATTACTAAAGG - Intergenic
996233454 5:121095955-121095977 ACTTACCACCACATTACTAAAGG + Intergenic
996807651 5:127475595-127475617 CCTTACTACTACTTTACTAAAGG - Intergenic
998705757 5:144757933-144757955 ACTTACCACCACATTACTAAAGG + Intergenic
1004003442 6:11617868-11617890 CCTGACTTCCACAATACTGATGG + Intergenic
1008073950 6:47126631-47126653 GCTTACCACCACATTACTAAGGG - Intergenic
1009477174 6:64107781-64107803 CCTTACCACTACATTACTAAAGG - Intronic
1010319679 6:74491383-74491405 TCTTACTACCACATTACCAAAGG - Intergenic
1012260194 6:97079628-97079650 CCTCAATACCACACTAGCTATGG - Intronic
1012925628 6:105264162-105264184 CCTTACCACCACATTACAAAAGG + Intergenic
1013168308 6:107614100-107614122 CCTTACTCCTACTGTACTTAAGG - Intronic
1014086411 6:117351104-117351126 CCTTACCACCGCATTACTAAAGG - Intronic
1014203357 6:118628069-118628091 CCTTACCACCACATTACTAAAGG + Intronic
1014771492 6:125462935-125462957 TCTTACCACCACATTACTGAAGG - Intergenic
1017031257 6:150224871-150224893 CCTTACTACCACACTACTTAAGG - Intronic
1017336870 6:153271717-153271739 CCTTACTACCACATTAAGAAAGG - Intergenic
1018097344 6:160400553-160400575 CCTCACCACCACATTACTAAAGG + Intronic
1018744777 6:166753721-166753743 CCTTATTACCACACTTATTGTGG + Intronic
1018939561 6:168300079-168300101 CCTTAGGACAACACTCCTTACGG - Intronic
1020412601 7:7909680-7909702 CCTTGCCACTACACTTCTTAAGG - Intronic
1020578032 7:9958738-9958760 CCCTGCTACTACATTACTTATGG + Intergenic
1020587962 7:10095456-10095478 TCTTACTACTACATTACTAAAGG - Intergenic
1021102648 7:16601445-16601467 CATTACTAACACACTATTGAGGG - Intronic
1021331747 7:19346820-19346842 CATTACCACCACAGTACTAAAGG - Intergenic
1021704380 7:23352236-23352258 CCATTCTACCACACTATTTGGGG + Intronic
1022783833 7:33615127-33615149 CCTTACCACCACATTACTAAAGG + Intergenic
1027549186 7:79569170-79569192 AATAAATACCACACTACTTATGG + Intergenic
1027817752 7:82998694-82998716 CCTTACCACCACATTACTAAAGG + Intronic
1028005399 7:85559928-85559950 CCCTCCCACCACTCTACTTAAGG + Intergenic
1031786166 7:126036006-126036028 CCTTTCTACCTCACTAGTTTTGG - Intergenic
1033985646 7:147222689-147222711 CCTTACCACCACATTACTAAAGG - Intronic
1039132060 8:34276168-34276190 ACCTACTACCACATTACTAACGG + Intergenic
1039834047 8:41242105-41242127 CTTTACCACCACATTACTAAGGG - Intergenic
1040822982 8:51585588-51585610 CATTCCTACCACTCTACTAAAGG - Intronic
1041334800 8:56770064-56770086 CCTTACCACCACATTACTAAAGG - Intergenic
1041870174 8:62625204-62625226 CCTTACCACTACATTACTAAAGG - Intronic
1044038754 8:87338857-87338879 CCTTACAACCACATTACTAAAGG - Intronic
1044777866 8:95712488-95712510 CCTTACTTCCATGCAACTTAGGG + Intergenic
1045620326 8:103970129-103970151 CCTTACCAGCACATTACTAAAGG - Intronic
1045804324 8:106139687-106139709 TCTTAGTACCACACTATTTCTGG - Intergenic
1047664049 8:127070526-127070548 CCTAACTCCCACATTACTCAAGG + Intergenic
1051048088 9:12899659-12899681 CTTTACTACCACATTACTAAAGG - Intergenic
1052081026 9:24205737-24205759 CTTTACTACCACATCACTAAAGG - Intergenic
1052438637 9:28464746-28464768 ACTTAATAGCTCACTACTTAAGG + Intronic
1056972413 9:91217666-91217688 CCTCAGTACCACACCAATTAGGG + Intronic
1057281122 9:93712354-93712376 CCACACTACCACACTATATATGG + Intergenic
1058281554 9:103122230-103122252 TCTTACCACCACAATACTAAAGG + Intergenic
1058491068 9:105500251-105500273 CCTTACTACCACATTAATAAAGG - Intronic
1059716280 9:116916276-116916298 CCTTCCTACCACAAGACTTTGGG - Intronic
1186543633 X:10426213-10426235 ACTTTCTGCCACACTACTTCTGG + Intergenic
1193680368 X:84511426-84511448 ATTTACTAGCACACTACTGAGGG + Intergenic
1196155979 X:112430968-112430990 CCTTACTGCTACATTACTAAAGG - Intergenic
1197030993 X:121815846-121815868 TCTTACCACCACATTACTAAAGG - Intergenic
1198446168 X:136716489-136716511 CCTTACCACCACATTACTAAAGG + Intronic
1198489081 X:137120217-137120239 CCTTAACACCACATTACTAAAGG + Intergenic