ID: 1017036791

View in Genome Browser
Species Human (GRCh38)
Location 6:150274244-150274266
Sequence CTCGAGCTGTCCAGCTTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017036787_1017036791 -5 Left 1017036787 6:150274226-150274248 CCACTTCCATGGCCTGTTCTCGA No data
Right 1017036791 6:150274244-150274266 CTCGAGCTGTCCAGCTTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017036791 Original CRISPR CTCGAGCTGTCCAGCTTGGC AGG Intergenic
No off target data available for this crispr