ID: 1017037641

View in Genome Browser
Species Human (GRCh38)
Location 6:150280737-150280759
Sequence TTGAATGAGCACCAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017037638_1017037641 -1 Left 1017037638 6:150280715-150280737 CCATCAATATTCATAGCTGTTAT No data
Right 1017037641 6:150280737-150280759 TTGAATGAGCACCAGGAGGAAGG No data
1017037635_1017037641 8 Left 1017037635 6:150280706-150280728 CCTATGGCCCCATCAATATTCAT No data
Right 1017037641 6:150280737-150280759 TTGAATGAGCACCAGGAGGAAGG No data
1017037633_1017037641 24 Left 1017037633 6:150280690-150280712 CCACATTCAGTGAAGACCTATGG No data
Right 1017037641 6:150280737-150280759 TTGAATGAGCACCAGGAGGAAGG No data
1017037636_1017037641 1 Left 1017037636 6:150280713-150280735 CCCCATCAATATTCATAGCTGTT No data
Right 1017037641 6:150280737-150280759 TTGAATGAGCACCAGGAGGAAGG No data
1017037637_1017037641 0 Left 1017037637 6:150280714-150280736 CCCATCAATATTCATAGCTGTTA No data
Right 1017037641 6:150280737-150280759 TTGAATGAGCACCAGGAGGAAGG No data
1017037632_1017037641 25 Left 1017037632 6:150280689-150280711 CCCACATTCAGTGAAGACCTATG No data
Right 1017037641 6:150280737-150280759 TTGAATGAGCACCAGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017037641 Original CRISPR TTGAATGAGCACCAGGAGGA AGG Intergenic
No off target data available for this crispr