ID: 1017040763

View in Genome Browser
Species Human (GRCh38)
Location 6:150307030-150307052
Sequence TGATAAGCTTGGAACTGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017040763_1017040767 -6 Left 1017040763 6:150307030-150307052 CCCTTCCAGTTCCAAGCTTATCA No data
Right 1017040767 6:150307047-150307069 TTATCATATAAGTGTGACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017040763 Original CRISPR TGATAAGCTTGGAACTGGAA GGG (reversed) Intergenic
No off target data available for this crispr