ID: 1017043001

View in Genome Browser
Species Human (GRCh38)
Location 6:150322847-150322869
Sequence CTCCTTAGTCACCCTGTATT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017042996_1017043001 9 Left 1017042996 6:150322815-150322837 CCAAGGGGCAATGAGCGATTCCT No data
Right 1017043001 6:150322847-150322869 CTCCTTAGTCACCCTGTATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017043001 Original CRISPR CTCCTTAGTCACCCTGTATT GGG Intergenic
No off target data available for this crispr