ID: 1017044545

View in Genome Browser
Species Human (GRCh38)
Location 6:150334812-150334834
Sequence GATCCCACAGCCAAGGCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017044537_1017044545 15 Left 1017044537 6:150334774-150334796 CCACGTTCATATTGTTTTCACTC No data
Right 1017044545 6:150334812-150334834 GATCCCACAGCCAAGGCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017044545 Original CRISPR GATCCCACAGCCAAGGCCTG GGG Intergenic
No off target data available for this crispr