ID: 1017047724

View in Genome Browser
Species Human (GRCh38)
Location 6:150363292-150363314
Sequence CCCTAGTCTCCAAAAATGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017047716_1017047724 -9 Left 1017047716 6:150363278-150363300 CCCTCCTCCCCTTCCCCTAGTCT No data
Right 1017047724 6:150363292-150363314 CCCTAGTCTCCAAAAATGCAAGG No data
1017047715_1017047724 8 Left 1017047715 6:150363261-150363283 CCTGAGATAGGCAACAACCCTCC No data
Right 1017047724 6:150363292-150363314 CCCTAGTCTCCAAAAATGCAAGG No data
1017047717_1017047724 -10 Left 1017047717 6:150363279-150363301 CCTCCTCCCCTTCCCCTAGTCTC No data
Right 1017047724 6:150363292-150363314 CCCTAGTCTCCAAAAATGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017047724 Original CRISPR CCCTAGTCTCCAAAAATGCA AGG Intergenic
No off target data available for this crispr