ID: 1017050897

View in Genome Browser
Species Human (GRCh38)
Location 6:150392376-150392398
Sequence CTGGACCTTCGTGGTTGTGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 95}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017050890_1017050897 2 Left 1017050890 6:150392351-150392373 CCCCGAGTGGGGCTCACACAGAG 0: 1
1: 0
2: 2
3: 19
4: 327
Right 1017050897 6:150392376-150392398 CTGGACCTTCGTGGTTGTGAAGG 0: 1
1: 0
2: 1
3: 5
4: 95
1017050892_1017050897 0 Left 1017050892 6:150392353-150392375 CCGAGTGGGGCTCACACAGAGCC 0: 1
1: 0
2: 7
3: 16
4: 181
Right 1017050897 6:150392376-150392398 CTGGACCTTCGTGGTTGTGAAGG 0: 1
1: 0
2: 1
3: 5
4: 95
1017050891_1017050897 1 Left 1017050891 6:150392352-150392374 CCCGAGTGGGGCTCACACAGAGC 0: 1
1: 0
2: 9
3: 238
4: 1396
Right 1017050897 6:150392376-150392398 CTGGACCTTCGTGGTTGTGAAGG 0: 1
1: 0
2: 1
3: 5
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017050897 Original CRISPR CTGGACCTTCGTGGTTGTGA AGG Exonic
900973090 1:6002206-6002228 CTGGTCCTCCCTGGTTCTGAAGG - Intronic
901036274 1:6338174-6338196 TAGGACCTTCCTGCTTGTGAGGG - Intronic
901143412 1:7050219-7050241 CTGGTCCTCCATGGTGGTGAAGG + Intronic
903650950 1:24921738-24921760 CAGCACCTTCTTGGTTATGACGG + Intronic
905927108 1:41759024-41759046 CTGGACCTTGATAGTGGTGATGG - Intronic
907542021 1:55224375-55224397 CTGGACCTCAGTCTTTGTGAGGG + Intergenic
916033065 1:160895190-160895212 CTGGACCTTCAGAGTTATGATGG + Intergenic
919309603 1:195891502-195891524 ATGGACCTTCCTGGTTCTGCAGG - Intergenic
1062793815 10:327128-327150 GAGGACCTGCGTGGTTGTGGCGG - Exonic
1065790500 10:29255866-29255888 CTGGACAGTAGGGGTTGTGAGGG + Intergenic
1078137123 11:8660786-8660808 CTGGACCTTCAAGTTTGTGTAGG + Intronic
1078221583 11:9355919-9355941 CTGGGCCTTGCTGGTTGTGGTGG - Intergenic
1078570172 11:12451058-12451080 CTGGTCCTTCCAGGGTGTGATGG - Intronic
1079053777 11:17187466-17187488 CTGAAACTTGGTGGTAGTGATGG - Intronic
1080659654 11:34285471-34285493 CTGCACCTTTGTGGTTAAGAAGG - Intronic
1081501154 11:43667963-43667985 ATGGACCTTGGTGCTTTTGAGGG + Intronic
1083315726 11:61813997-61814019 CTGGACGTTGGGGGGTGTGAGGG - Intronic
1083436571 11:62647337-62647359 CTGCACCTTAGTGGCTGTCATGG - Exonic
1085042630 11:73335472-73335494 CTGGACCTTCCAGGCTGGGAAGG - Intronic
1091408981 12:226811-226833 GTGGACCTACGTGGTAGAGAGGG - Intronic
1091983821 12:4890810-4890832 CTAGAGATGCGTGGTTGTGATGG + Intergenic
1092590537 12:9949689-9949711 CTGGAACCTCGTGATTGTGTTGG + Intergenic
1093316831 12:17662727-17662749 CTGCACTTCCGAGGTTGTGAAGG - Intergenic
1093484090 12:19634825-19634847 CTAGAACTTCTTGGTTCTGAGGG + Intronic
1093970783 12:25374091-25374113 CTGGACCTTGGAGGTTGACAGGG + Intergenic
1098025135 12:66193587-66193609 CTGGCTCTTCTTGGCTGTGATGG + Intronic
1099407859 12:82285159-82285181 CTGGACCTCCATGCCTGTGATGG - Intronic
1100027373 12:90146992-90147014 CTTGACATTCCTGGTTGTGGAGG - Intergenic
1106567160 13:30896309-30896331 CAGGACCTTGGTGGTGGTGACGG + Intergenic
1111543270 13:89696690-89696712 CTTGGCCATCGTGGTTGGGAAGG - Intergenic
1113127395 13:106995155-106995177 CTGGGCCTTTGTGGTTGGAATGG - Intergenic
1113907692 13:113827599-113827621 CGGGACCTTCGGTGTTGTGAGGG - Intronic
1116119076 14:40698280-40698302 CTGAACCTTTCTGGTTCTGAGGG - Intergenic
1120324681 14:83009436-83009458 CTGGGCCTCTGTGCTTGTGATGG - Intergenic
1122679965 14:103452295-103452317 CTGGACATGGGTGGTGGTGAGGG - Intronic
1126319605 15:47407911-47407933 CTGCACCTTGGTGGTGGTGGTGG + Intronic
1127767979 15:62206619-62206641 CTAGACCTTGGTGTGTGTGATGG + Intergenic
1128369817 15:67032491-67032513 CTGGAACCTGGTGGTAGTGATGG - Intergenic
1136287539 16:29253310-29253332 CTGGACCTTCCTGGCTGTCTCGG + Intergenic
1138585216 16:57964758-57964780 TTGGACCTTGGGGGCTGTGAGGG - Intronic
1140253928 16:73318939-73318961 CTGGCCCTTCTTGCTTGTGGAGG + Intergenic
1146652766 17:34616658-34616680 CTGCAGCTTCGTGGTGGGGAAGG + Intronic
1151990292 17:77570261-77570283 CGGGACCTTCGTGGATGGGATGG + Intergenic
1152490854 17:80632343-80632365 CAGGCCCTTCGGGGTTGTGTAGG + Intronic
1158598746 18:58839022-58839044 CTGGCCCTGTGTGGTTCTGATGG - Intergenic
927884260 2:26708910-26708932 CTGGACCAGCGTGGTGGTGGTGG + Intronic
928403458 2:30996207-30996229 CTGGGCCTTCCTGCCTGTGATGG - Intronic
929318837 2:40515102-40515124 CTGAGCCTTCCTGGTGGTGATGG - Intronic
930113020 2:47695193-47695215 CTTGACCTTTGTGTGTGTGATGG - Intergenic
933549477 2:83757297-83757319 CTGTACCTTAGTTGTGGTGATGG - Intergenic
935076002 2:99744563-99744585 ATGGAAATTGGTGGTTGTGAGGG - Intronic
944696294 2:202203109-202203131 CTGGATTTACGTGGTTCTGAAGG - Intergenic
1173922266 20:46755247-46755269 CTGGACCAGTGTGGTAGTGATGG - Intergenic
1175690197 20:61059709-61059731 GAGGACCTACCTGGTTGTGATGG + Intergenic
1176422789 21:6529743-6529765 CTGGAGGTTGGTGGTAGTGATGG - Intergenic
1179698282 21:43138060-43138082 CTGGAGGTTGGTGGTAGTGATGG - Intergenic
951092241 3:18587754-18587776 TGGTTCCTTCGTGGTTGTGAGGG + Intergenic
953708587 3:45250146-45250168 CTGGACCTCCGGGTATGTGAAGG + Intergenic
955856624 3:63279092-63279114 CTGGACCTTCGTGGGGATGAGGG + Intronic
956606973 3:71082997-71083019 CTGGATCTACGTGGTTTTAAGGG + Intronic
959728517 3:109573540-109573562 CTTGACCTTGCTGCTTGTGATGG + Intergenic
962417740 3:135198885-135198907 CTGCAGCTTAGTGGTTGTGTGGG - Intronic
963853981 3:150235442-150235464 CTGGACCTTGGAGGATGTGTGGG + Intergenic
966052952 3:175643810-175643832 CAGGAGATTCTTGGTTGTGAAGG - Intronic
967527386 3:190510523-190510545 TTGAACCATGGTGGTTGTGATGG + Intergenic
968109019 3:196027251-196027273 GTGGACCTTCCTGGGGGTGAGGG + Intronic
969158251 4:5232124-5232146 CTGGACCTTTTTGATAGTGAAGG + Intronic
970089011 4:12382593-12382615 ATGGAACTTCTTGGATGTGAAGG - Intergenic
972115579 4:35629020-35629042 CTGTACCTCCATGGTTGGGAAGG - Intergenic
980408948 4:132389928-132389950 CTGCACCTTCCAGCTTGTGATGG - Intergenic
984793067 4:183631865-183631887 CTCGACTTTAATGGTTGTGAGGG - Intergenic
985512248 5:319309-319331 CTGGACCTTCGTGGTGGGGAGGG + Intronic
985649290 5:1099843-1099865 GGGGACCGTGGTGGTTGTGAAGG - Intronic
989717070 5:44476871-44476893 CTTGACCTTTGTGTATGTGATGG - Intergenic
997193105 5:131958283-131958305 CTGGGCCTACGTGGATTTGAAGG - Intronic
999398232 5:151244423-151244445 CTGGTCCTTGGTGGGTGTGTAGG - Intronic
999950855 5:156648863-156648885 GTGAACCTTCGTGTCTGTGATGG + Intronic
1003094773 6:3133549-3133571 CTGGACACTGGTGGTTGGGAGGG - Intronic
1003110442 6:3248434-3248456 CTGGACCTTTGGGGTTGTGCTGG + Intronic
1006177357 6:32130388-32130410 CTGGAGCTTCATGGTTGCGGAGG - Intergenic
1007847245 6:44769558-44769580 CCTGACCTTCCTTGTTGTGATGG + Intergenic
1009969228 6:70609102-70609124 CTGGACCTTCAGAGTTATGATGG - Intergenic
1011754228 6:90482883-90482905 CTGGGCCTTCCTGGTCCTGAAGG - Intergenic
1014275105 6:119379279-119379301 CTGGACCTGTTAGGTTGTGATGG + Intergenic
1015785221 6:136916319-136916341 CTGGATCTCCCTGGGTGTGATGG - Intergenic
1017050897 6:150392376-150392398 CTGGACCTTCGTGGTTGTGAAGG + Exonic
1030806774 7:113929502-113929524 CTGGGCCTCCGGGGCTGTGATGG - Intronic
1037667221 8:20980604-20980626 CTTGACCTTGGTGGTTTTTAGGG + Intergenic
1041388639 8:57329959-57329981 AGGGACCTTTGTGTTTGTGATGG - Intergenic
1051323342 9:15935070-15935092 CTGGAACTACATGGTGGTGATGG + Intronic
1056100869 9:83299562-83299584 CAGGAAGTTCGTGGTTGTTAGGG + Intronic
1057371035 9:94473483-94473505 CTGAACCTTCCTGGTTATGTTGG + Intergenic
1059515904 9:114895095-114895117 TTGGAGCCTCCTGGTTGTGAAGG + Intronic
1060697856 9:125724570-125724592 CTTTTCCTTGGTGGTTGTGAAGG - Intergenic
1187702025 X:21971937-21971959 CTGGACCTTCAGAGTTATGATGG + Exonic
1190345271 X:49331845-49331867 CAGCGGCTTCGTGGTTGTGAAGG + Intronic
1191202852 X:57803327-57803349 CTGGACCTTGGGGTCTGTGATGG - Intergenic
1193231232 X:79049371-79049393 GGGGACCTTGGTGGATGTGAGGG + Intergenic
1193925992 X:87485960-87485982 CTGTACCTTAGTGTTTGTGTAGG - Intergenic
1194185039 X:90765327-90765349 CTAGACCTTCAGGCTTGTGATGG + Intergenic
1194948651 X:100098285-100098307 CTGGATATGGGTGGTTGTGATGG + Intergenic
1196200210 X:112878297-112878319 CTGGAACTTTGTGGCTGTGCTGG - Intergenic