ID: 1017051772

View in Genome Browser
Species Human (GRCh38)
Location 6:150400061-150400083
Sequence GTTCACCTGAATCCCAAGCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 117}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017051772_1017051776 -6 Left 1017051772 6:150400061-150400083 CCCTGCTTGGGATTCAGGTGAAC 0: 1
1: 0
2: 0
3: 18
4: 117
Right 1017051776 6:150400078-150400100 GTGAACAAATGTAACGTGGGTGG 0: 1
1: 0
2: 1
3: 4
4: 63
1017051772_1017051775 -9 Left 1017051772 6:150400061-150400083 CCCTGCTTGGGATTCAGGTGAAC 0: 1
1: 0
2: 0
3: 18
4: 117
Right 1017051775 6:150400075-150400097 CAGGTGAACAAATGTAACGTGGG 0: 1
1: 0
2: 0
3: 3
4: 110
1017051772_1017051777 -5 Left 1017051772 6:150400061-150400083 CCCTGCTTGGGATTCAGGTGAAC 0: 1
1: 0
2: 0
3: 18
4: 117
Right 1017051777 6:150400079-150400101 TGAACAAATGTAACGTGGGTGGG 0: 1
1: 0
2: 1
3: 1
4: 102
1017051772_1017051774 -10 Left 1017051772 6:150400061-150400083 CCCTGCTTGGGATTCAGGTGAAC 0: 1
1: 0
2: 0
3: 18
4: 117
Right 1017051774 6:150400074-150400096 TCAGGTGAACAAATGTAACGTGG 0: 1
1: 0
2: 0
3: 4
4: 80
1017051772_1017051779 1 Left 1017051772 6:150400061-150400083 CCCTGCTTGGGATTCAGGTGAAC 0: 1
1: 0
2: 0
3: 18
4: 117
Right 1017051779 6:150400085-150400107 AATGTAACGTGGGTGGGTGAGGG 0: 1
1: 0
2: 0
3: 8
4: 132
1017051772_1017051778 0 Left 1017051772 6:150400061-150400083 CCCTGCTTGGGATTCAGGTGAAC 0: 1
1: 0
2: 0
3: 18
4: 117
Right 1017051778 6:150400084-150400106 AAATGTAACGTGGGTGGGTGAGG 0: 1
1: 0
2: 2
3: 21
4: 279

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017051772 Original CRISPR GTTCACCTGAATCCCAAGCA GGG (reversed) Exonic
901140638 1:7027055-7027077 GTTCACATGAATCCCAGGGAAGG - Intronic
901668380 1:10839318-10839340 GGACCCCTGACTCCCAAGCACGG + Intergenic
901706359 1:11076466-11076488 GTTCACCTGGATGCCCAGCAGGG - Intronic
901978177 1:13011899-13011921 TCTCACCTGAGTCCCCAGCAGGG + Intronic
902003908 1:13217039-13217061 TCTCACCTGAGTCCCCAGCAGGG - Intergenic
902023132 1:13362783-13362805 TCTCACCTGAGTCCCCAGCAGGG - Intergenic
904068270 1:27772375-27772397 GTTCATCTATATCCCAAGCCGGG - Intergenic
907464102 1:54623717-54623739 GGTCTCCTGACTCCCAAGCAGGG - Intronic
909747768 1:79120107-79120129 ATACACCTGAATCCAAAGCCTGG + Intergenic
911711301 1:101076734-101076756 TTTCAGCTCAATCCAAAGCAGGG + Intergenic
912511633 1:110193960-110193982 GGTCACCTGACCCACAAGCATGG + Intronic
917062173 1:171052916-171052938 GCTCACCTGAATTAGAAGCATGG - Intronic
918147111 1:181766595-181766617 GCTCACCTGCATCCCAATGATGG - Exonic
918732233 1:188013270-188013292 CTCCACCTGAAGCCCAGGCACGG - Intergenic
919836514 1:201578400-201578422 GTTCCCCTGGAAACCAAGCAGGG - Intergenic
920037746 1:203076637-203076659 TTCCCCCAGAATCCCAAGCATGG - Exonic
920971093 1:210744322-210744344 GTGCACCAGAATCACATGCAGGG + Intronic
924920792 1:248627078-248627100 GTTCACCAGAAGCCCCAGGAGGG + Exonic
1062868931 10:881585-881607 GTTTACCTGAGTTCCAGGCAGGG - Intronic
1068098901 10:52527450-52527472 GTACACCCGTAACCCAAGCAGGG + Intergenic
1068746985 10:60543821-60543843 GTTTACCTGAAATCCCAGCATGG + Intronic
1073552125 10:104413359-104413381 TTTCACGTTAATCCCAAGCAAGG - Intronic
1073834842 10:107429396-107429418 GGTACCCTGAATCCCAAGTAAGG - Intergenic
1075278601 10:121118970-121118992 GATCACCTGAAGGCCAATCAGGG - Intergenic
1077106607 11:844980-845002 GTTCAGCTGAATCCCAGCCAGGG - Intronic
1077914737 11:6603861-6603883 CTTCTCCTGAGTCCCAAGTAAGG + Exonic
1078746799 11:14123446-14123468 GTTCAACTGAAACCCTAGAAAGG - Intronic
1081781002 11:45712688-45712710 GGTCACCAGAATCCCCAGCCAGG - Intergenic
1088213085 11:107477766-107477788 GCTCACTTCAGTCCCAAGCAGGG - Intergenic
1088921577 11:114263079-114263101 CTTCACCCCCATCCCAAGCATGG + Intronic
1089616995 11:119700359-119700381 GATCTCCTGACTCCCAAGCCAGG - Intronic
1089652075 11:119920943-119920965 GCACCCCTGAAGCCCAAGCAGGG - Intergenic
1089809423 11:121119446-121119468 GTCCACCTGGATTTCAAGCAGGG + Intronic
1091274000 11:134337834-134337856 GTTCAACTGAATCCAAATCCAGG - Intronic
1091291292 11:134441353-134441375 GTTCACCAGGCTCCCAGGCAAGG + Intergenic
1092362309 12:7847447-7847469 GTTCATCTGAATCACAAGGAAGG + Intronic
1094463816 12:30728984-30729006 ATACACCTAAATCCAAAGCAGGG - Exonic
1095416928 12:41987473-41987495 GCTCTCCTCCATCCCAAGCAGGG + Intergenic
1098761832 12:74434810-74434832 GTTGTCCTGCATCCCAACCATGG + Intergenic
1099345547 12:81495238-81495260 GTTTACCTGAATGCCAAGTATGG + Intronic
1100860823 12:98804574-98804596 GTACAGCTGAATCCCAGCCAAGG - Intronic
1102297450 12:111747956-111747978 GTTCACCTGATTCCAAGGCCCGG + Intronic
1103519875 12:121531171-121531193 GTTCCCTTCCATCCCAAGCAGGG + Intronic
1109644943 13:65241740-65241762 GGTCACCAGAATCCCAAGATGGG + Intergenic
1110418820 13:75281376-75281398 GTGCACCTGTCACCCAAGCAGGG + Intergenic
1112417477 13:99215764-99215786 GTTCTGCTGAAGCTCAAGCAAGG + Intronic
1116926039 14:50638592-50638614 TTTCACCTGTATCCAGAGCAGGG + Intronic
1117623686 14:57613738-57613760 GGTCACCTGACTCCCAAGTCTGG - Intronic
1121329460 14:93040811-93040833 GTTCTCCTGCCTCCCAAGCTTGG - Intronic
1121829868 14:97041897-97041919 GTTCAGCTGAATCTCCAGAAAGG - Intergenic
1121967581 14:98324847-98324869 GCTCAGCTGAAAGCCAAGCATGG - Intergenic
1122080078 14:99261040-99261062 GTTCACCCGATTCCAAAGAACGG + Intronic
1124013936 15:25861046-25861068 GTTCACCAGAAGCCTGAGCAGGG - Intronic
1128450533 15:67803644-67803666 TTTTCCCTGAATCCCATGCAGGG + Intronic
1129062847 15:72874062-72874084 GTTCTCATGAATTCCAAGCCAGG - Intergenic
1130436992 15:83910612-83910634 GTTCACCTAAACTCCCAGCAGGG - Intronic
1134231962 16:12436536-12436558 GCCCTCCTGAATCCCAAGCCAGG - Intronic
1137545353 16:49399248-49399270 GTTCACCGGAATACCCAGCATGG + Exonic
1141695700 16:85618087-85618109 GTTCACCTGCATCTCTAGCCAGG + Intronic
1142211769 16:88811814-88811836 GTGCACCTGAATACCACGCCTGG + Exonic
1143475950 17:7204053-7204075 GTTCACCTGCAACTCCAGCACGG + Exonic
1146746650 17:35336796-35336818 GCTCCTCTGTATCCCAAGCATGG - Intergenic
1147522848 17:41190783-41190805 CTTCAGCAGAATCCCAAGCATGG - Intronic
1157118504 18:44885367-44885389 GAGCACATGAATCCCAAGAAAGG + Intronic
1157821391 18:50773288-50773310 GTTCTCCTGATTCACAAGCATGG - Intergenic
1159652818 18:70997696-70997718 GGTCACCTACATCCCAGGCAGGG + Intergenic
1161238970 19:3211339-3211361 GCTCACCTGACTCCGGAGCATGG + Intergenic
1163870818 19:19820138-19820160 TTTCACATGTGTCCCAAGCAGGG - Intronic
1163874925 19:19859999-19860021 TTTCACATGTGTCCCAAGCAGGG - Intergenic
1163969399 19:20777569-20777591 TTTCACATGTGTCCCAAGCAGGG + Intronic
1163993599 19:21022248-21022270 TTTCACCTGTGTCCCAAGCAGGG + Intronic
1164003486 19:21128502-21128524 TTTCACCTGTGTCCCAAGCAGGG - Intergenic
1164005319 19:21143000-21143022 TTTCACCTGTGTCCCAAGCAGGG + Intronic
1164017835 19:21268556-21268578 TTTCACCTGTGTCCCAGGCAGGG - Intronic
1164026823 19:21360289-21360311 TTTCACCTGGGTCCCAATCAGGG + Intronic
1164115330 19:22214202-22214224 TTTCACATGTGTCCCAAGCAGGG - Intergenic
1164136453 19:22421377-22421399 TTTCACATGGGTCCCAAGCAGGG - Intronic
1164316002 19:24088452-24088474 TTTCACATGTATCCCAAGCAGGG + Intronic
932340811 2:70961579-70961601 GTTCACCTGGATACACAGCAGGG - Exonic
935629788 2:105203970-105203992 GTTCTACTGCATACCAAGCATGG + Intergenic
936653199 2:114453978-114454000 TTTCTCCTTCATCCCAAGCAAGG - Intronic
937763734 2:125635163-125635185 CTTCCCTTGAATCTCAAGCAGGG + Intergenic
942275828 2:174322893-174322915 GTTCACTTAAAACCCAGGCAAGG - Intergenic
942321420 2:174739911-174739933 GATCACCTGAAGTCCAAGCCTGG - Intergenic
943640154 2:190348955-190348977 GCTCTCCTGTATCCCAAGCAAGG + Exonic
1173824861 20:46041615-46041637 ATTTAGCTGAATCCCAAGGAGGG - Intronic
1174436720 20:50512422-50512444 GTTGACCTGTCACCCAAGCATGG + Intronic
1176327618 21:5515611-5515633 GTTCACCACACCCCCAAGCATGG - Intergenic
1176400139 21:6305340-6305362 GTTCACCACACCCCCAAGCATGG + Intergenic
1176437018 21:6683764-6683786 GTTCACCACACCCCCAAGCATGG - Intergenic
1176461280 21:7010834-7010856 GTTCACCACACCCCCAAGCATGG - Intergenic
1176484841 21:7392612-7392634 GTTCACCACACCCCCAAGCATGG - Intergenic
1178091211 21:29165422-29165444 GTACACCTGTCACCCAAGCAGGG + Intronic
1179092713 21:38282243-38282265 GTACACCAGTAACCCAAGCAGGG - Intronic
1179457848 21:41511785-41511807 ATTGACCTTAATCACAAGCATGG + Intronic
1183582313 22:38733343-38733365 GAGCTCCTGAATCCCAAGAATGG - Exonic
1184716089 22:46282564-46282586 GTGCACTTGGCTCCCAAGCAGGG + Intronic
952708075 3:36400172-36400194 GGTCACCTGACTCCCAAACCTGG + Intronic
955131545 3:56174436-56174458 GGTGACCTGAATCACCAGCATGG - Intronic
956674528 3:71721941-71721963 TTTCGCCTTCATCCCAAGCAGGG - Intronic
963410978 3:144927189-144927211 GTTCAGCTGAATTCTAAGCTTGG + Intergenic
966506511 3:180708443-180708465 GTTCTCCCAAATCCCAAGTAAGG - Intronic
970670305 4:18389132-18389154 GTTCAGTTGAATCCCACCCAGGG + Intergenic
978121551 4:105085487-105085509 CATCACCTGAAGCCCAAGCAAGG + Intergenic
978714762 4:111828109-111828131 GTTCACCAGAATACAAAGGAAGG - Intergenic
985813012 5:2103956-2103978 GCTCACCTGACTCCAAAGCCAGG + Intergenic
993101372 5:83544316-83544338 TTTAACGTGAATCCCAAACATGG + Intronic
995889329 5:116933459-116933481 AATCACCTGAGTCCCAGGCAGGG + Intergenic
997375903 5:133397379-133397401 GATCTCCTGAGTCACAAGCAGGG - Intronic
999632119 5:153582078-153582100 GGTCTCCTGAATCTCTAGCATGG + Intronic
1000528604 5:162389633-162389655 GTTGACCTGATTCCCCAGAAGGG + Intergenic
1001110612 5:168893221-168893243 GTTCACCTGATTCAAAAGGATGG + Intronic
1011576430 6:88805657-88805679 GAGCACCTGAATCGCAGGCATGG - Intronic
1013919375 6:115382842-115382864 GTGCAGCTGAATTCCAGGCATGG - Intergenic
1017051772 6:150400061-150400083 GTTCACCTGAATCCCAAGCAGGG - Exonic
1019378109 7:706888-706910 CTTCACTTGTATCCCAAGCAGGG - Intronic
1025802025 7:64795361-64795383 TTTCACATGTGTCCCAAGCAGGG + Intronic
1025865245 7:65374826-65374848 TTTCACATGTGTCCCAAGCAGGG + Intronic
1025995440 7:66524605-66524627 CTTCCCCTGAGGCCCAAGCAGGG - Intergenic
1026987092 7:74561475-74561497 CTTCCCCTGAGGCCCAAGCAGGG - Intronic
1032186218 7:129728926-129728948 GTTCTCCTTAATTCCAACCATGG - Intronic
1035872974 8:3155921-3155943 TTTCACCTGCATCCCATGCAAGG + Intronic
1038191525 8:25325462-25325484 GGTCACCTTCACCCCAAGCAAGG + Exonic
1039360444 8:36871011-36871033 GACCACCAGAATCCCTAGCAGGG + Intronic
1041472283 8:58224163-58224185 GTTCACCTGTGTCCCTAGTAGGG - Intergenic
1045187388 8:99852955-99852977 GTTCACCTGAGACAGAAGCAAGG + Intronic
1048325603 8:133436708-133436730 GCTCTCCTGAGTCCCTAGCAGGG - Intergenic
1052067065 9:24034964-24034986 GGCCACCTGATTCCCAACCAGGG - Intergenic
1053222131 9:36320791-36320813 GTTCCCCTGCATCCCAAGGGAGG - Intergenic
1060872793 9:127056183-127056205 GTTTCCCTGAGTCCCCAGCAAGG - Intronic
1060919722 9:127411746-127411768 GTTCACATGATGGCCAAGCACGG + Intergenic
1062529324 9:136992969-136992991 GTTCAGGTGAGACCCAAGCAGGG + Exonic
1203434494 Un_GL000195v1:124896-124918 GTTCACCACACCCCCAAGCATGG + Intergenic
1188311233 X:28619302-28619324 GTTTACCTGAAGGCCAGGCATGG + Intronic
1191859282 X:65652729-65652751 GTTCTCCTGACTCCCAGGCTAGG - Intronic
1199705604 X:150422294-150422316 GATTCCCTGAATCCCAAGCCAGG - Intronic