ID: 1017053883

View in Genome Browser
Species Human (GRCh38)
Location 6:150420512-150420534
Sequence CTGAATGAATGTATGGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017053883_1017053891 27 Left 1017053883 6:150420512-150420534 CCCTGCTCCATACATTCATTCAG No data
Right 1017053891 6:150420562-150420584 TCTGTCATCTTCTAGTACCATGG No data
1017053883_1017053889 0 Left 1017053883 6:150420512-150420534 CCCTGCTCCATACATTCATTCAG No data
Right 1017053889 6:150420535-150420557 GGATCCAGGCTCTTTCAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017053883 Original CRISPR CTGAATGAATGTATGGAGCA GGG (reversed) Intergenic
No off target data available for this crispr