ID: 1017054720

View in Genome Browser
Species Human (GRCh38)
Location 6:150426481-150426503
Sequence CAGTGTTCTCAGAGGAAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017054715_1017054720 10 Left 1017054715 6:150426448-150426470 CCGTGGTATGTGCATGGAGCTGC No data
Right 1017054720 6:150426481-150426503 CAGTGTTCTCAGAGGAAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017054720 Original CRISPR CAGTGTTCTCAGAGGAAGGA GGG Intergenic
No off target data available for this crispr