ID: 1017055392

View in Genome Browser
Species Human (GRCh38)
Location 6:150431432-150431454
Sequence ATGTAGAACCAGAAGCAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017055384_1017055392 16 Left 1017055384 6:150431393-150431415 CCACCGCACCCAGCTGAGGATTT No data
Right 1017055392 6:150431432-150431454 ATGTAGAACCAGAAGCAGGAGGG No data
1017055385_1017055392 13 Left 1017055385 6:150431396-150431418 CCGCACCCAGCTGAGGATTTTAT No data
Right 1017055392 6:150431432-150431454 ATGTAGAACCAGAAGCAGGAGGG No data
1017055386_1017055392 8 Left 1017055386 6:150431401-150431423 CCCAGCTGAGGATTTTATTTTCC No data
Right 1017055392 6:150431432-150431454 ATGTAGAACCAGAAGCAGGAGGG No data
1017055387_1017055392 7 Left 1017055387 6:150431402-150431424 CCAGCTGAGGATTTTATTTTCCC No data
Right 1017055392 6:150431432-150431454 ATGTAGAACCAGAAGCAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017055392 Original CRISPR ATGTAGAACCAGAAGCAGGA GGG Intergenic
No off target data available for this crispr