ID: 1017056799

View in Genome Browser
Species Human (GRCh38)
Location 6:150443863-150443885
Sequence ATGGTGCAGCAGAAAGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017056794_1017056799 2 Left 1017056794 6:150443838-150443860 CCCAGGACAGATGCTTCTCACGA No data
Right 1017056799 6:150443863-150443885 ATGGTGCAGCAGAAAGAGGCTGG No data
1017056791_1017056799 24 Left 1017056791 6:150443816-150443838 CCTGTGACTGTACCAGGCAAGTC No data
Right 1017056799 6:150443863-150443885 ATGGTGCAGCAGAAAGAGGCTGG No data
1017056793_1017056799 12 Left 1017056793 6:150443828-150443850 CCAGGCAAGTCCCAGGACAGATG No data
Right 1017056799 6:150443863-150443885 ATGGTGCAGCAGAAAGAGGCTGG No data
1017056790_1017056799 28 Left 1017056790 6:150443812-150443834 CCATCCTGTGACTGTACCAGGCA No data
Right 1017056799 6:150443863-150443885 ATGGTGCAGCAGAAAGAGGCTGG No data
1017056795_1017056799 1 Left 1017056795 6:150443839-150443861 CCAGGACAGATGCTTCTCACGAG No data
Right 1017056799 6:150443863-150443885 ATGGTGCAGCAGAAAGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017056799 Original CRISPR ATGGTGCAGCAGAAAGAGGC TGG Intergenic
No off target data available for this crispr