ID: 1017064601

View in Genome Browser
Species Human (GRCh38)
Location 6:150517745-150517767
Sequence ACTTGGTGATAGAGGGAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017064601_1017064608 -4 Left 1017064601 6:150517745-150517767 CCCCCTTCCCTCTATCACCAAGT No data
Right 1017064608 6:150517764-150517786 AAGTCTTCTCAGCCCCTCCCTGG No data
1017064601_1017064609 -3 Left 1017064601 6:150517745-150517767 CCCCCTTCCCTCTATCACCAAGT No data
Right 1017064609 6:150517765-150517787 AGTCTTCTCAGCCCCTCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017064601 Original CRISPR ACTTGGTGATAGAGGGAAGG GGG (reversed) Intergenic
No off target data available for this crispr