ID: 1017073734

View in Genome Browser
Species Human (GRCh38)
Location 6:150599844-150599866
Sequence GAGCAGTGGGGCCGAGCCCG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 0, 3: 43, 4: 252}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017073715_1017073734 27 Left 1017073715 6:150599794-150599816 CCGCCGAAGCTGGCGTCTGGGCG 0: 1
1: 0
2: 1
3: 2
4: 51
Right 1017073734 6:150599844-150599866 GAGCAGTGGGGCCGAGCCCGAGG 0: 1
1: 0
2: 0
3: 43
4: 252
1017073730_1017073734 -10 Left 1017073730 6:150599831-150599853 CCGGGGCGCGGCCGAGCAGTGGG 0: 1
1: 0
2: 3
3: 16
4: 164
Right 1017073734 6:150599844-150599866 GAGCAGTGGGGCCGAGCCCGAGG 0: 1
1: 0
2: 0
3: 43
4: 252
1017073716_1017073734 24 Left 1017073716 6:150599797-150599819 CCGAAGCTGGCGTCTGGGCGCGG 0: 1
1: 0
2: 0
3: 2
4: 90
Right 1017073734 6:150599844-150599866 GAGCAGTGGGGCCGAGCCCGAGG 0: 1
1: 0
2: 0
3: 43
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017073734 Original CRISPR GAGCAGTGGGGCCGAGCCCG AGG Exonic
900098571 1:951222-951244 GGGCAGTGGGGATGAGCCTGGGG + Exonic
900162813 1:1232368-1232390 GCGCTGCGCGGCCGAGCCCGGGG + Exonic
900661053 1:3783957-3783979 GTGGGGTGGGGCCGGGCCCGGGG - Intronic
901719464 1:11184883-11184905 GTGGAGGGGGGCCGTGCCCGGGG - Intronic
903044449 1:20554432-20554454 GAGAATTGGGGCCGGGCCGGCGG + Exonic
906365323 1:45205667-45205689 GAGCCCTGGGGCCGAGACCCCGG - Intronic
907077919 1:51595011-51595033 CAGCAGTGGGGCCGAACTCCTGG - Intronic
907387143 1:54133373-54133395 TACCAGGGGGGCAGAGCCCGAGG + Intronic
908117523 1:60954428-60954450 AAGCAGTGGGGCCTTGACCGGGG - Intronic
915167866 1:153958550-153958572 GAGGAGCCGGGCCGAGGCCGCGG - Exonic
919463249 1:197902953-197902975 GCGCAGGCGCGCCGAGCCCGGGG - Intronic
922279892 1:224114010-224114032 GAGGAGTGGGGAGGAGCCTGTGG - Intergenic
923094150 1:230761383-230761405 GAGCAGTGGGGAGGAGCCTCAGG - Intronic
924955783 1:248925323-248925345 GGGCAGTGGGGCCCAGGCAGGGG + Intergenic
1062904643 10:1171665-1171687 GAGCAGTGGCCCCTACCCCGTGG + Intergenic
1067852408 10:49762161-49762183 GAGCTGTGGGGCCGGTCCCCAGG + Intronic
1069834774 10:71301528-71301550 GACCAGTGAGGCCGAGCCCATGG - Exonic
1069898931 10:71695958-71695980 CAGCCGTGGGGGCCAGCCCGTGG - Intronic
1071287605 10:84163297-84163319 AAGCAGTGGGGACGAGACTGGGG - Intergenic
1071601507 10:86960765-86960787 GAGCAGTGGGGCGCACCCCAGGG + Intronic
1072549974 10:96469874-96469896 GAGCTGTGGGGTCGATCCCAGGG + Intronic
1072615751 10:97048055-97048077 GAGCAGTGGGGCTGGGGCCTGGG - Intronic
1073100054 10:101001770-101001792 TGGCAGTGGGGCAGAGCCTGTGG + Exonic
1073288798 10:102403243-102403265 GAGCTGTGACGCTGAGCCCGGGG + Exonic
1073462118 10:103671761-103671783 GAGCAGTGGGGGGGAGGCGGGGG + Intronic
1074923751 10:118046613-118046635 GAGGAGCCGGGCCGAGCCTGCGG - Intergenic
1075777743 10:124999120-124999142 GACCAGAGGGGCCGAGCCAGGGG + Intronic
1076488032 10:130836721-130836743 TAGGAGTGGGGTTGAGCCCGCGG - Intergenic
1076707035 10:132307809-132307831 GAGGAGTGGCGCCGAGCGCAGGG - Exonic
1076834413 10:133013923-133013945 GAGGGGTGGGGCCCAGCCCCGGG + Intergenic
1077201491 11:1309642-1309664 GCGCAGTGGGGCGGTGCCGGGGG - Intronic
1081569263 11:44279407-44279429 GAGGAGTGGGGCTGGGCCCTGGG + Intronic
1083278143 11:61609055-61609077 GAGGAGTGAGGCCAAGCCCAAGG - Intergenic
1083846074 11:65334259-65334281 GAGGAGCGGGGCCGAGGCCCGGG + Intronic
1083878976 11:65539007-65539029 CAGAAGTGAGGCCGAGCTCGCGG + Exonic
1088522268 11:110712474-110712496 GAGCGGAGGGGGCGGGCCCGAGG - Intronic
1088814234 11:113410491-113410513 GAGCTGGGGGGCCCAGCCCCAGG + Exonic
1090640592 11:128726187-128726209 GGGCAGGGGGGCTGAGCCAGCGG - Intronic
1091393375 12:139112-139134 GGGGAGAGGGGCCGAGGCCGAGG + Exonic
1091792718 12:3280939-3280961 GAGCCAAGGGGCCCAGCCCGAGG + Intronic
1091840059 12:3614360-3614382 AGGCAGTGGGGCCCAGCGCGAGG - Intronic
1092181709 12:6451061-6451083 GGGCAGTGGGGTTGAGCCAGTGG - Intronic
1094174065 12:27524076-27524098 CAGCAGTGGGGCGGGGCCGGGGG - Intronic
1095640270 12:44478856-44478878 GAGCTGTGGGTCTGAGCCCCGGG - Intergenic
1097662895 12:62449873-62449895 GAGCCATGGGGCCAAGCCCGTGG - Intergenic
1101711134 12:107267851-107267873 CAGCAGTGTGGCCCAGCCTGGGG + Intergenic
1101943818 12:109120767-109120789 GAGCTGGAGGGCCCAGCCCGGGG + Intronic
1105004194 12:132710920-132710942 GAGCACGGCGGCCGAGCCCCCGG - Exonic
1105794180 13:23834135-23834157 GGGGAGAGGGGCCGAGCCCCCGG + Intronic
1107187878 13:37546070-37546092 CAGCAGTGGGGTGGAGCGCGGGG + Intergenic
1107605227 13:42049186-42049208 GAGGGGTGGGGCGGGGCCCGGGG + Intronic
1108536435 13:51385260-51385282 GAGGGGTGGGGCAGAGCCAGAGG - Intronic
1113379031 13:109786388-109786410 GAGCCGCGGGGCCGAGCCTAAGG + Exonic
1113836760 13:113333107-113333129 GAGGAGAGGGGCCCAGCCGGAGG + Intronic
1116856840 14:49960136-49960158 GAGGAGTGGAGCCGAGCTCCAGG - Intergenic
1117262336 14:54048514-54048536 GAACAGCAGGGCGGAGCCCGCGG - Intergenic
1117723146 14:58646519-58646541 GAAGAGTGGGGGCGGGCCCGAGG + Exonic
1118885554 14:69863029-69863051 GAGCAGAGGGGCTGAGGCCAAGG + Intronic
1119106722 14:71932236-71932258 GAGCCGTGCGGCGGCGCCCGCGG + Intergenic
1121314824 14:92954697-92954719 AAGCAGTGTGGCCCAGCTCGTGG - Intronic
1121339018 14:93094029-93094051 GAGCGGTGGAGCCGAGGCGGTGG - Intronic
1122275950 14:100590903-100590925 GAGCAGTGGGCCAGACCCCTGGG - Intergenic
1122804656 14:104250334-104250356 GGGGAATGGGGCCGAGGCCGGGG + Intergenic
1123038002 14:105479091-105479113 GAGGAGTGAGGCCGAGCCCCGGG - Intronic
1124696798 15:31870453-31870475 GGGCGGCGGGGCCGGGCCCGCGG - Intronic
1125507104 15:40273242-40273264 GAGCTGTGGGGCCTAGCACCAGG + Intronic
1125852820 15:42920731-42920753 GAGCGGTGGGGACGAGGCGGCGG - Intronic
1128944017 15:71809539-71809561 GAGCTGTGAGGCCGAGTTCGGGG + Intronic
1129665668 15:77578185-77578207 GAGATGTGGGGCAGAGCCCTGGG - Intergenic
1130512496 15:84601062-84601084 GAGGGGCCGGGCCGAGCCCGGGG + Exonic
1132610789 16:815170-815192 GAGAAGTGGGGCCGAGATGGGGG + Intergenic
1132871453 16:2117420-2117442 AAGCACTGGGGCAGAGCCTGCGG - Intronic
1132903737 16:2271823-2271845 AAGCAGTGGGGTCAGGCCCGGGG - Intergenic
1133006020 16:2882432-2882454 GGGTAGTGGGGGCGACCCCGCGG + Intergenic
1133028389 16:2998401-2998423 GAGGTGTGGGGCAGAGCCAGGGG - Intergenic
1133273979 16:4625541-4625563 GAGGAGTGGGGCTGGGCCCAAGG + Intronic
1134090545 16:11389313-11389335 GACCAGTGGGCCCCAGCCTGTGG + Intronic
1134134743 16:11670927-11670949 GAGCATGGGGGCAGAGCCGGGGG - Intronic
1134521074 16:14919474-14919496 AAGCAGTGGGGCAGAGCCTGCGG + Intronic
1134550497 16:15136498-15136520 AAGCAGTGGGGCAGAGCCTGCGG - Intronic
1134708750 16:16318125-16318147 AAGCAGTGGGGCAGAGCCTGCGG + Intergenic
1134715964 16:16358159-16358181 AAGCAGTGGGGCAGAGCCTGTGG + Intergenic
1134950855 16:18350520-18350542 AAGCAGTGGGGCAGAGCCTGCGG - Intergenic
1134958792 16:18394000-18394022 AAGCAGTGGGGCAGAGCCTGCGG - Intergenic
1136073909 16:27805117-27805139 GGGCAGTGGGGCTGAGACTGGGG + Intronic
1136543523 16:30942423-30942445 TGGCAGTGGGGCTGAGCCCAGGG - Exonic
1138196073 16:55053192-55053214 GAGCACTGGGGCCCCGCCCCAGG + Intergenic
1138527277 16:57616381-57616403 GAGCAGAGAGGCTGAGCCCGCGG + Intronic
1139390799 16:66605361-66605383 GACCTGCGGGGCCGAGCCGGCGG + Intronic
1139670829 16:68491693-68491715 GAGCAGTGGGGCAGGGGTCGCGG + Intergenic
1140018225 16:71209637-71209659 GAGCTTTGGGGCAGAGACCGTGG - Intronic
1142216174 16:88831211-88831233 GAGCGGTGAGGCCGAGCACGGGG + Intronic
1142216184 16:88831247-88831269 GAGCGGTGAGGCCGAGCACGGGG + Intronic
1142216194 16:88831283-88831305 GAGCGGTGAGGCCGAGCACGGGG + Intronic
1142216204 16:88831319-88831341 GAGCGGTGAGGCCGAGCACGGGG + Intronic
1142216214 16:88831355-88831377 GAGCGGTGAGGCCGAGCACGGGG + Intronic
1142216224 16:88831391-88831413 GAGCGGTGAGGCCGAGCACGGGG + Intronic
1142216234 16:88831427-88831449 GAGCGGTGAGGCCGAGCACGGGG + Intronic
1142216244 16:88831463-88831485 GAGCGGTGAGGCCGAGCACGGGG + Intronic
1142216254 16:88831499-88831521 GAGCGGTGAGGCCGAGCACGGGG + Intronic
1142216264 16:88831535-88831557 GAGCGGTGAGGCCGAGCACGGGG + Intronic
1142216274 16:88831571-88831593 GAGCGGTGAGGCCGAGCACGGGG + Intronic
1142216284 16:88831607-88831629 GAGCGGTGAGGCCGAGCACGGGG + Intronic
1142216294 16:88831643-88831665 GAGCGGTGAGGCCGAGCACGGGG + Intronic
1142216304 16:88831679-88831701 GAGCGGTGAGGCCGAGCACGGGG + Intronic
1142216314 16:88831715-88831737 GAGCGGTGAGGCCGAGCACGGGG + Intronic
1142216324 16:88831751-88831773 GAGCGGTGAGGCCGAGCACGGGG + Intronic
1142216334 16:88831787-88831809 GAGCGGTGAGGCCGAGCACGGGG + Intronic
1142312733 16:89323466-89323488 GGGCAGGGGGGCAGAGCCCAGGG + Intronic
1142312742 16:89323486-89323508 GGGCAGGGGGGCAGAGCCCAGGG + Intronic
1142312782 16:89323586-89323608 GGGCAGGGGGGCTGAGCCCGGGG + Intronic
1142546432 17:707058-707080 GGGCAGTGTGGCAGACCCCGTGG - Intronic
1142624070 17:1180971-1180993 AAGCAGTGGGGCCCACCCAGGGG + Intronic
1143608113 17:8002704-8002726 GGGCCGTGGGCCCGAGCCCCCGG + Exonic
1143651999 17:8268999-8269021 GTGCAGTGGAGCCAAGCCCCTGG - Exonic
1143781548 17:9232031-9232053 GAGCACTGGGGCTGAGCCAGAGG + Intronic
1144707316 17:17378139-17378161 GACCAGTGGGGCTCAGCCCTGGG - Intergenic
1144717830 17:17446729-17446751 GAGCAGTGGGGCAGGGACAGAGG - Intergenic
1144995203 17:19263312-19263334 GAGAAGTGGGGCCCATCCCTGGG + Intronic
1147110287 17:38256837-38256859 GAGCAGTTAGGCCGCGCCCGCGG - Intergenic
1147139716 17:38454145-38454167 GAGCCGCGGGGCCGGGGCCGGGG + Intronic
1148419223 17:47531594-47531616 GAGCAGTTAGGCCGCGCCCGCGG + Intronic
1148755636 17:49971714-49971736 CAGCAGTGGGGTCGAGGCAGGGG + Intronic
1148836732 17:50469483-50469505 GAGGGGTGGGGGCGCGCCCGAGG - Intronic
1149855415 17:60078652-60078674 GAGGGGTGGGGCCGGGGCCGGGG + Intronic
1150002716 17:61451796-61451818 GAGCAGAAGGGCCGTGCCCAGGG + Intergenic
1150652061 17:67016698-67016720 GAGCAGGGGGGCTGACCCGGGGG + Intronic
1152742317 17:82023682-82023704 GGAGAGTGGGGCCGAGCCCCAGG + Exonic
1156502169 18:37566850-37566872 GAGCTGTCGGGCCGCGCCGGGGG + Intergenic
1157508193 18:48246831-48246853 GAGCTGTGGGGCAGAGGCCAGGG - Intronic
1160894214 19:1395173-1395195 GGGCAGTGGGGCCTTGCCCAGGG + Intronic
1160987910 19:1848157-1848179 GGGCAGGGGAGCCGAGCCCAAGG + Intronic
1161062141 19:2220484-2220506 GAGCACTGGGGCCGACCTCACGG - Intronic
1161319584 19:3634739-3634761 GAGCATGGAGGCAGAGCCCGAGG - Intronic
1161353945 19:3808932-3808954 GAGCAGTGCGGCTGGGCCCCTGG - Exonic
1161356625 19:3822832-3822854 GAGCAGTGGAGCCGAGCTCCTGG - Intronic
1161585342 19:5102560-5102582 GAGGAATGGGGCCGGGGCCGGGG + Intronic
1161637044 19:5395402-5395424 AAGCAATGGGGCCGGGCGCGTGG + Intergenic
1161714458 19:5867442-5867464 GAGCAGCGGGGCAGAGCCACGGG + Exonic
1162100076 19:8334043-8334065 GAACGGTGGCGCCGAGCCCCCGG - Exonic
1162440492 19:10689133-10689155 GAGCCGAGGGGCCCAGCCAGCGG - Intronic
1163354367 19:16800247-16800269 GAGCCATGGGGCCCAGCCTGTGG - Intronic
1165468197 19:35987417-35987439 GAGCACAGGGGCGGAGCGCGGGG - Intergenic
1165856404 19:38881255-38881277 GAGCAGTGGGGACCGGCCAGGGG + Intronic
1167307133 19:48715688-48715710 GAGGAAAGGGGCCGTGCCCGAGG + Exonic
1167964496 19:53132396-53132418 GAGCAGCGGGGCCCGGCACGAGG + Intronic
926796863 2:16626536-16626558 GAGTAGTGGGGCAGATCCCTGGG - Intronic
927606563 2:24491495-24491517 GAGCCGCGGCGCCGGGCCCGAGG + Intergenic
932430335 2:71670350-71670372 GGGCAGTGGGGCAGACCCCATGG + Intronic
934011416 2:87824693-87824715 GAGAGGTGAGGCCGAGGCCGAGG + Intronic
934188108 2:89763854-89763876 CAGCAGTGCAGCCGAGCCCCAGG - Intergenic
934993317 2:98936326-98936348 GCGGAGTGGGGCCGAGACCTCGG + Intergenic
938163806 2:129009204-129009226 GAGAATGGGGGCCGAGCCCGGGG + Intergenic
942277261 2:174332494-174332516 GAGCAGGGCGCCGGAGCCCGAGG + Intergenic
947200876 2:227613501-227613523 GAGCAGTGGGGCGGGGGCTGAGG - Intronic
948026766 2:234784699-234784721 GAGAAGTGGGGCAGAACCTGAGG + Intergenic
948299295 2:236890038-236890060 GAGCAGTGGGCCCCAGCTGGAGG + Intergenic
948479589 2:238241117-238241139 GGGCGGTGGGGCCGCGCCCTCGG + Intergenic
948776794 2:240293373-240293395 GAGCTGTGGGGCCGTGTCCAGGG + Intergenic
1170791852 20:19515262-19515284 TATCTGTGGGGCCGAGCCCCAGG + Intronic
1171201408 20:23245083-23245105 GAGGGGTGGGGCAGCGCCCGGGG - Intergenic
1172698378 20:36837367-36837389 GAGCAGTGAGGCCAAGCTGGAGG + Intronic
1172702693 20:36862903-36862925 GAGCAGCGACGCCGAGTCCGCGG - Exonic
1173070669 20:39761735-39761757 TAGAAGTGGGGCCGAGCAGGAGG - Intergenic
1173226941 20:41167674-41167696 GAACAGTGAGGCCGGGCCTGAGG + Intronic
1173852404 20:46227458-46227480 GAGCCGTGGGGCGGGGCCAGGGG - Intronic
1175358615 20:58389547-58389569 CAGCACTGGGGCGGAGGCCGCGG - Intronic
1175913120 20:62413996-62414018 TCGGAGTGGGGCCGGGCCCGGGG - Exonic
1176089210 20:63311572-63311594 GAGGAGTGGGGCAGAGCGAGTGG + Intronic
1178583461 21:33854725-33854747 GAACAGTTGGGCCAAACCCGTGG + Intronic
1179880285 21:44290769-44290791 GGGCAGTGGGGCCAGGCCCAGGG - Intronic
1180043465 21:45292255-45292277 GAGCAGGGGGAGCGCGCCCGGGG - Intergenic
1180921649 22:19524461-19524483 GGGCCGGGGGGCCGGGCCCGGGG - Exonic
1181814898 22:25430377-25430399 GAGCAGGGTGGCAGAGCACGTGG - Intergenic
1183302430 22:37064922-37064944 GAGCAGTGGGGATGATCCAGTGG - Intergenic
1183386750 22:37519401-37519423 GCGCAGGGGGGCGGTGCCCGTGG + Exonic
1183520621 22:38294375-38294397 CCGCAGTGCCGCCGAGCCCGTGG - Exonic
1183949465 22:41344604-41344626 GAGGAGTGGGGCAGATCCCTGGG - Intronic
1184033116 22:41906254-41906276 GAGGAGGGGGGCCCAGCCCTGGG + Exonic
1184035164 22:41914721-41914743 GAGCGGAGGAGCCGAGCCGGAGG - Intergenic
1184759862 22:46537904-46537926 GAGCCGCGGCCCCGAGCCCGAGG - Intergenic
1185126974 22:49016773-49016795 GAGATGTGGGCCCGAGCCCAGGG - Intergenic
1185417393 22:50717747-50717769 GAGCACTGGGGCCGATCTCCAGG - Intergenic
951785152 3:26410360-26410382 CATCAGTGGGGTCGAGCCTGTGG + Intergenic
952141689 3:30486271-30486293 CAGCAGTGGGGCCCAGGCAGTGG + Intergenic
952945321 3:38475053-38475075 ATGCAGTGGGGCCCAGCCTGGGG + Intronic
953404604 3:42654280-42654302 GAGCAGTGGGGACGGGCTGGGGG + Intronic
953766347 3:45746612-45746634 GAGCACGGGGGCCGCGCCTGGGG + Intergenic
954200894 3:49022487-49022509 GAGCGCAGGGGCCGAGCACGCGG - Exonic
955916333 3:63912142-63912164 GGGCAGCCGGGCCGGGCCCGGGG + Intronic
960333634 3:116391724-116391746 GAGCATGGGGGCTGAGCCCGGGG + Intronic
967876349 3:194270788-194270810 GAGCAGTGGGGTCAGGCCTGCGG - Intergenic
968464663 4:744683-744705 GAGCAGGTGGGCGGGGCCCGGGG + Exonic
968464678 4:744740-744762 GAGCAGGTGGGCGGGGCCCGGGG + Intronic
968464693 4:744797-744819 GAGCAGGTGGGCGGGGCCCGGGG + Intronic
968464723 4:744911-744933 GAGCAGGTGGGCGGGGCCCGGGG + Intronic
968464738 4:744968-744990 GAGCAGGTGGGCGGGGCCCGGGG + Intronic
968464784 4:745140-745162 GAGCAGGTGGGCGGGGCCCGGGG + Intronic
968464798 4:745196-745218 GAGCAGGTGGGCGGGGCCCGGGG + Intronic
968464812 4:745252-745274 GAGCAGGTGGGCGGGGCCCGGGG + Intronic
968464827 4:745309-745331 GAGCAGGTGGGCGGGGCCCGGGG + Intronic
968464842 4:745366-745388 GAGCAGGTGGGCGGGGCCCGGGG + Intronic
968464857 4:745423-745445 GAGCAGGTGGGCGGGGCCCGGGG + Intronic
968464887 4:745537-745559 GAGCAGGTGGGCGGGGCCCGGGG + Intronic
968464902 4:745594-745616 GAGCAGGTGGGCGGGGCCCGGGG + Intronic
968464917 4:745651-745673 GAGCAGGTGGGCGGGGCCCGGGG + Intronic
968464932 4:745708-745730 GAGCAGGTGGGCGGGGCCCGGGG + Intronic
968464962 4:745822-745844 GAGCAGGTGGGCGGGGCCCGGGG + Intronic
968464977 4:745879-745901 GAGCAGGTGGGCGGGGCCCGGGG + Intronic
968465007 4:745993-746015 GAGCAGGTGGGCGGGGCCCGGGG + Intronic
968465037 4:746107-746129 GAGCAGGTGGGCGGGGCCCGGGG + Intronic
968465053 4:746163-746185 GAGCAGGTGGGCGGGGCCCGGGG + Intronic
968465068 4:746220-746242 GAGCAGGTGGGCGGGGCCCGGGG + Intronic
968465083 4:746277-746299 GAGCAGGTGGGCGGGGCCCGGGG + Intronic
968465129 4:746449-746471 GAGCAGGTGGGCGGGGCCCGGGG + Intronic
968465143 4:746505-746527 GAGCAGGTGGGCGGGGCCCGGGG + Intronic
968465157 4:746561-746583 GAGCAGGTGGGCGGGGCCCGGGG + Intronic
968465172 4:746618-746640 GAGCAGGTGGGCGGGGCCCGGGG + Intronic
968465187 4:746675-746697 GAGCAGGTGGGCGGGGCCCGGGG + Intronic
968465202 4:746732-746754 GAGCAGGTGGGCGGGGCCCGGGG + Intronic
968465217 4:746789-746811 GAGCAGGTGGGCGGGGCCCGGGG + Intronic
968465248 4:746904-746926 GAGCAGGTGGGCGGGGCCCGGGG + Intronic
968465263 4:746961-746983 GAGCAGGTGGGCGGGGCCCGGGG + Intronic
968465277 4:747017-747039 GAGCAGGTGGGCGGGGCCCGGGG + Intronic
968465322 4:747188-747210 GAGCAGGTGGGCGGGGCCCGGGG + Intronic
968465352 4:747302-747324 GAGCAGGTGGGCGGGGCCCGGGG + Intronic
968465367 4:747359-747381 GAGCAGGTGGGCGGGGCCCGGGG + Intronic
968465398 4:747474-747496 GAGCAGGTGGGCGGGGCCCGGGG + Intronic
968465413 4:747531-747553 GAGCAGGTGGGCGGGGCCCGGGG + Intronic
968465427 4:747587-747609 GAGCAGGTGGGCGGGGCCCGGGG + Intronic
968583974 4:1407365-1407387 CAGCAGAGGGGCGGAGCCGGCGG + Intergenic
969785551 4:9454448-9454470 AAACAGTGGGGCCCAGGCCGAGG + Intergenic
971128152 4:23776874-23776896 GAGCTGTGGGGCTGAGAGCGTGG + Intronic
973212486 4:47631796-47631818 GAGCAGAGGGGCCTTGCCCTGGG - Intronic
976629373 4:87220699-87220721 GAGCCGCGGGGGCGAGGCCGTGG - Intronic
977064977 4:92303907-92303929 GAGCAGCGGGGCCGGGCCAGAGG - Intronic
978885371 4:113761516-113761538 GTGCAGCGGGGCCGAGGCCGCGG + Intronic
982781772 4:159498692-159498714 GAGGAGTCAGGCCTAGCCCGAGG - Intergenic
985070023 4:186158589-186158611 GAGCATTGCCGCCCAGCCCGAGG + Intronic
987431898 5:17845015-17845037 GAGCTGTGGGCCCAAGCCAGGGG + Intergenic
990246382 5:53867408-53867430 GAGCAGTGGGAAAGAGCACGGGG - Intergenic
992018055 5:72595611-72595633 GATCCCTGGGGCCTAGCCCGGGG - Intergenic
992078928 5:73216237-73216259 GAGCTGTGGCGCAGAGCACGCGG + Intergenic
996900459 5:128537722-128537744 GAGCAGGGAGCCCGAGCCCGAGG - Exonic
997364824 5:133319112-133319134 GTGAGGTGGGGCCGAGCCTGGGG - Intronic
1004829047 6:19457646-19457668 GTGCCGTGGGGCAGAGCCCAGGG - Intergenic
1006285350 6:33089063-33089085 TAGCAGTGAGGCCGAGCCAGGGG + Intergenic
1006932697 6:37697377-37697399 GATCAGGAGGGCCGGGCCCGGGG - Exonic
1007774863 6:44219416-44219438 GAGAAGGGGGTCCGAGCCCTTGG + Intergenic
1009742050 6:67758596-67758618 GAGCTGTGGGGGCAAGCCTGAGG - Intergenic
1015812270 6:137172641-137172663 GCGGAGTGGGGCCGAGGTCGGGG - Intronic
1017073734 6:150599844-150599866 GAGCAGTGGGGCCGAGCCCGAGG + Exonic
1019331701 7:463602-463624 CCGCAGTGGGGCCGGGGCCGCGG - Intergenic
1020046805 7:5046362-5046384 GAGCCGTGGGGCAGAGGCTGCGG + Exonic
1020069252 7:5214905-5214927 GAGCAGTGTGGCAGAGGCCCGGG - Intronic
1020069589 7:5217582-5217604 GAGCAGTGGGGCTGGGCGCGGGG - Intronic
1020112716 7:5456489-5456511 GAGCAGGGAGGCAGAGCCTGAGG + Intronic
1020288714 7:6706444-6706466 GAGCGGTGGGGCAGAGGCTGCGG - Exonic
1024811721 7:53219508-53219530 GAGGAGTGGGGAAGAGACCGAGG + Intergenic
1027116501 7:75485876-75485898 GAGCCGTGGGGCAGAGGCTGCGG - Exonic
1027138018 7:75638640-75638662 GATGTGTGGGGCTGAGCCCGTGG - Intronic
1027152019 7:75739456-75739478 GGGCAGTGGGGCCTCCCCCGGGG + Intergenic
1027275325 7:76549827-76549849 GAGCCGTGGGGCAGAGGCTGCGG + Intergenic
1029223510 7:99008563-99008585 TAGCAGTGGGGCCGGGCCGGGGG + Intronic
1029721036 7:102364377-102364399 GAGCCGTGGGGCAGAGGCTGCGG + Exonic
1031317272 7:120273371-120273393 GCGCGGTGGGGCCGGGGCCGGGG - Intergenic
1035357070 7:158282495-158282517 GAGCAGCGGGGTCGAGGCTGCGG + Intronic
1035769847 8:2138356-2138378 GAGCAGCTGGGCGGAGCCTGGGG + Intronic
1036434773 8:8723308-8723330 AAGCAGGTGGTCCGAGCCCGGGG + Intergenic
1036752066 8:11449666-11449688 CAGCAGTGGGGACAAGCCCTTGG + Intronic
1037585691 8:20274517-20274539 GAGCATTGGGTCCGAGCCTGTGG + Intronic
1037769884 8:21792242-21792264 GAGCAGTGTGGCCCAGGCCTAGG - Intronic
1037825218 8:22156574-22156596 GAGCGGTGGGGCGGGGGCCGCGG - Exonic
1038176433 8:25185051-25185073 GCGCAGCCGGGCCGAGCCCCCGG - Intronic
1039864598 8:41490335-41490357 GAGCTGTGGGGCTGCGGCCGGGG - Intergenic
1040017186 8:42709176-42709198 GAGAAGAGGGGCTGAGCCTGGGG + Intronic
1040471347 8:47738000-47738022 GGGCCGCGGGGCCGAGCCAGGGG - Exonic
1040480243 8:47819041-47819063 GAGCAGTGGGGAAGAGGCAGGGG - Intronic
1041045068 8:53880716-53880738 GAGCAGTGGGGCTGCGGCCGGGG + Intronic
1042181097 8:66088298-66088320 GAGCAGTGGGGCCCTGGCCCTGG + Intronic
1049203705 8:141353718-141353740 GAGCTGTGGGGCCCAGTCCAGGG + Intergenic
1049224385 8:141442711-141442733 GAGCACAGGGGCCGGGCCAGGGG - Intergenic
1049352388 8:142171181-142171203 GTGCCGTGGGGCAGAGCCTGGGG + Intergenic
1049497660 8:142943972-142943994 TAGCAGTGGGGCTCAGCCCCAGG - Intergenic
1054800584 9:69344576-69344598 GAGCAGTGGGGCCCTGCCTCTGG + Intronic
1056763817 9:89432537-89432559 GTGCAGTGGGGCACACCCCGTGG + Intronic
1056768592 9:89460607-89460629 GAGCAGTGGGTCTGAACCGGTGG - Intronic
1060587098 9:124793340-124793362 GAGCTGTAGGGCAGAGCCCTGGG + Intronic
1060867387 9:127011068-127011090 TAGCAGTGTGGCCAAGCCAGGGG + Intronic
1061384741 9:130282588-130282610 GAGCAGAGGGGCCGGGGCCACGG + Intergenic
1189337013 X:40176344-40176366 GATCCGTGAGGCCGAGGCCGGGG - Intronic
1189445480 X:41076852-41076874 GTGCTGAGGGGCCGAGGCCGCGG + Intergenic
1196140138 X:112252609-112252631 CAGCAATGGGGCAGAGCCAGCGG - Intergenic
1197952055 X:131908229-131908251 GAGGGTTGGGGCGGAGCCCGGGG + Intergenic
1199445047 X:147911826-147911848 GGGCCGAGGGGCTGAGCCCGCGG + Intergenic
1201338504 Y:12905531-12905553 GAGCAGAGGGGCCAGGCCTGTGG + Intronic