ID: 1017073822

View in Genome Browser
Species Human (GRCh38)
Location 6:150600098-150600120
Sequence CCACATCCGCAGGTGGGGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 233}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017073803_1017073822 19 Left 1017073803 6:150600056-150600078 CCAGGGATGGGAGGGGGGACCCG 0: 1
1: 0
2: 4
3: 35
4: 373
Right 1017073822 6:150600098-150600120 CCACATCCGCAGGTGGGGCCGGG 0: 1
1: 0
2: 1
3: 20
4: 233
1017073812_1017073822 -8 Left 1017073812 6:150600083-150600105 CCTCCGGCGGGAGCCCCACATCC 0: 1
1: 1
2: 0
3: 8
4: 140
Right 1017073822 6:150600098-150600120 CCACATCCGCAGGTGGGGCCGGG 0: 1
1: 0
2: 1
3: 20
4: 233
1017073811_1017073822 -1 Left 1017073811 6:150600076-150600098 CCGGGGACCTCCGGCGGGAGCCC 0: 1
1: 0
2: 1
3: 12
4: 168
Right 1017073822 6:150600098-150600120 CCACATCCGCAGGTGGGGCCGGG 0: 1
1: 0
2: 1
3: 20
4: 233
1017073810_1017073822 0 Left 1017073810 6:150600075-150600097 CCCGGGGACCTCCGGCGGGAGCC 0: 1
1: 0
2: 0
3: 9
4: 155
Right 1017073822 6:150600098-150600120 CCACATCCGCAGGTGGGGCCGGG 0: 1
1: 0
2: 1
3: 20
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017073822 Original CRISPR CCACATCCGCAGGTGGGGCC GGG Intronic
900140256 1:1136869-1136891 CCACAAAGGCACGTGGGGCCAGG - Intergenic
900551318 1:3257370-3257392 CCACACCAGCAGCTGGTGCCCGG - Intronic
900646044 1:3709150-3709172 AAACAACCGCAGGTGGGGGCGGG - Intronic
900902736 1:5527824-5527846 CCACACAGGCAGGTGGGGGCAGG + Intergenic
900992501 1:6104439-6104461 CCACCTCCGGAGGTGGAACCGGG - Exonic
901438187 1:9262317-9262339 CGACCTTCGCAGGTGGGCCCTGG + Exonic
901800689 1:11706423-11706445 CCACCACCGCCGGCGGGGCCCGG + Exonic
902394798 1:16126733-16126755 GCAGTTCCGCAGGTGGGGCAAGG + Intronic
902847105 1:19120169-19120191 GCACATCTACAGGTAGGGCCAGG - Exonic
903217583 1:21851878-21851900 CCGCATCGGCAGGTGAGGCCTGG + Exonic
903318258 1:22525777-22525799 CCACAGGCCCAGGTGGGCCCGGG - Intronic
904052563 1:27648568-27648590 CCTCATCCTCAGGTGGGCCAGGG + Intergenic
904467693 1:30718182-30718204 CCACATCAGAGGGCGGGGCCTGG - Intronic
904833789 1:33322074-33322096 CAACAAACTCAGGTGGGGCCTGG + Intergenic
906514781 1:46432436-46432458 CAACAGCCCCAGGTGAGGCCAGG - Intergenic
907755219 1:57304356-57304378 CCACTACTGGAGGTGGGGCCTGG - Intronic
908102808 1:60808718-60808740 CTAAATCCACAGGTGGGGCAAGG + Intergenic
912800869 1:112719087-112719109 CATCATCCGCAGGGCGGGCCGGG - Intergenic
912861287 1:113216232-113216254 CCAATGCCGGAGGTGGGGCCTGG - Intergenic
914900192 1:151707496-151707518 CCCCATCCTCAGGTATGGCCTGG - Exonic
915109360 1:153553262-153553284 CCACATCTGCAGTGGGGGCGGGG - Intergenic
922170698 1:223152008-223152030 ACAAATCTGGAGGTGGGGCCTGG + Intergenic
922932056 1:229397508-229397530 CCAGATCTTCAGGTGTGGCCTGG - Intergenic
923540135 1:234882871-234882893 CCCCATCCGCAGGTGCAGGCAGG + Intergenic
1063167236 10:3474411-3474433 CCAGACCTGCAGGTGGGCCCTGG + Intergenic
1063470047 10:6277148-6277170 CCAGTGCTGCAGGTGGGGCCTGG + Intergenic
1063523481 10:6761570-6761592 TGACATCGGCAGATGGGGCCAGG + Intergenic
1064271243 10:13868505-13868527 AAACATACGCAGGTGTGGCCAGG + Intronic
1064654095 10:17539496-17539518 CCACTGCTGGAGGTGGGGCCTGG + Intergenic
1064913836 10:20434637-20434659 CCAGTTCTGGAGGTGGGGCCTGG + Intergenic
1066201673 10:33147783-33147805 CCAGAGCTGGAGGTGGGGCCTGG + Intergenic
1067716969 10:48697366-48697388 ACACGTCCCCAGGTGAGGCCAGG - Intronic
1068921185 10:62486073-62486095 CCAGTTCTGGAGGTGGGGCCTGG + Intronic
1069718892 10:70537895-70537917 CTTCATGAGCAGGTGGGGCCTGG + Exonic
1072264790 10:93716789-93716811 CCACTGCTGGAGGTGGGGCCTGG - Intergenic
1073293451 10:102424638-102424660 CCACATCCCCAGGTAGGTTCTGG - Exonic
1073980003 10:109143504-109143526 CCAATTCTGGAGGTGGGGCCAGG + Intergenic
1074493610 10:113959965-113959987 ACACATCCGGTGCTGGGGCCAGG + Intergenic
1076853220 10:133103142-133103164 CCACATCTGCAGCTGGAGCCCGG + Intronic
1077222244 11:1422895-1422917 CCACATCACCAGGTTGGGACTGG - Intronic
1078268615 11:9773944-9773966 CCCCAACTGGAGGTGGGGCCTGG - Intergenic
1083853399 11:65380399-65380421 GTGCATCCTCAGGTGGGGCCTGG - Intronic
1084219745 11:67670722-67670744 CGGCATCTGCAGGTGTGGCCAGG - Intronic
1085028274 11:73253042-73253064 CCACATCCTCAAGTGGTGACAGG + Intergenic
1085297007 11:75437038-75437060 CCATCTCTGCAGGTGGCGCCTGG - Exonic
1085508437 11:77073265-77073287 CCACCTCCACAAGTGTGGCCAGG + Intronic
1087024018 11:93632102-93632124 CAGCATGTGCAGGTGGGGCCTGG - Intergenic
1089582169 11:119488415-119488437 CCACCTCCAGAGTTGGGGCCAGG - Intergenic
1090967733 11:131613438-131613460 CCCCATCCTCAGGTGGCTCCTGG + Intronic
1092507981 12:9124392-9124414 CCACAGCCGCAGTTTGGGCGGGG - Intergenic
1093547680 12:20368242-20368264 CCTCCTCCGCAGGAGGGGGCGGG + Intergenic
1093913152 12:24769819-24769841 CCATTTCAGCAGGTGGGGCTTGG + Intergenic
1097260997 12:57720252-57720274 TCACAGCTGCAGGTGGGCCCTGG + Exonic
1101982736 12:109421715-109421737 CCACATCATGAGGTGGGGGCTGG + Intronic
1103593173 12:122006608-122006630 CCTCACCTGCAGGTGGGACCGGG - Intergenic
1104037107 12:125105136-125105158 TCCAATCTGCAGGTGGGGCCTGG - Intronic
1104787475 12:131459031-131459053 CCAGATCCGCAGGGAGGGCAGGG - Intergenic
1105008344 12:132737102-132737124 CCCCCTCCGCAGGTCAGGCCTGG + Intronic
1105533117 13:21237783-21237805 CCACTGCTGGAGGTGGGGCCCGG + Intergenic
1108455390 13:50608536-50608558 CCACAGCAGCAGGTGGGTCCTGG + Intronic
1108678948 13:52762980-52763002 CCACCTCCCCACGTGGCGCCTGG - Intergenic
1110342831 13:74413456-74413478 CCACGTCCGCAGCTGTGGCTGGG - Intergenic
1112363003 13:98733852-98733874 CCAAAGCTGGAGGTGGGGCCTGG + Intronic
1112472491 13:99701599-99701621 CCACATCCTCAGGCCGGGCGCGG - Intronic
1113863729 13:113507986-113508008 CCCCATCTGCAGGTGCGCCCAGG - Intronic
1114051451 14:18921927-18921949 CCCCATCCCCAGGTCGGGCTGGG - Intergenic
1114111110 14:19479997-19480019 CCCCATCCCCAGGTCGGGCTGGG + Intergenic
1120047808 14:79828085-79828107 CCAAAGCTGGAGGTGGGGCCTGG - Intronic
1121146830 14:91591348-91591370 TCAAATACGCAGTTGGGGCCGGG - Intronic
1122086354 14:99309356-99309378 CCACTGCTGGAGGTGGGGCCTGG + Intergenic
1122623745 14:103073912-103073934 AAACCCCCGCAGGTGGGGCCAGG + Intergenic
1122970588 14:105150563-105150585 CCAGAGCAGCAGGTGGGGCAGGG + Intronic
1123019942 14:105392954-105392976 CCACATGCGCAGGCAGGGGCGGG + Intronic
1202862365 14_GL000225v1_random:90602-90624 GCACTGCCGCAGGTGGAGCCAGG + Intergenic
1124187393 15:27542323-27542345 CCCCAGCTGCAGGTGTGGCCTGG - Intergenic
1124252711 15:28117447-28117469 CCACGTCCACAGCTGCGGCCCGG + Intronic
1124349318 15:28943774-28943796 CCACAGCCCAAGGAGGGGCCAGG - Intronic
1124735458 15:32242358-32242380 TCACATCCTCACATGGGGCCTGG - Intergenic
1126225124 15:46261606-46261628 CCCCATAAGCAGGTGTGGCCAGG + Intergenic
1126672542 15:51129454-51129476 CCACTTCCTCAGGTGTGCCCTGG - Intergenic
1130330491 15:82918482-82918504 CCACCTCAGCAGGTGAGGCTGGG + Intronic
1131092504 15:89633130-89633152 GAACAGCAGCAGGTGGGGCCAGG - Exonic
1132678560 16:1130629-1130651 ACACATCCACAGGTGGGCCCAGG - Intergenic
1132752380 16:1464778-1464800 CCCCAGCCGCTGGTGAGGCCGGG - Intronic
1133220077 16:4316072-4316094 CCACATCTGCAGCTCGGGCAGGG - Intronic
1133224543 16:4334667-4334689 CCACATGCACAGGTAGGGGCTGG + Intronic
1135002746 16:18790489-18790511 CGACCTCCCCCGGTGGGGCCTGG + Intronic
1135177793 16:20246327-20246349 CCACATGCTCAGATGGAGCCAGG - Intergenic
1138366510 16:56482843-56482865 CCACATCTGCAGGGGAGGCCGGG - Intronic
1139573223 16:67826135-67826157 CCACATCTGCATGTGGGGAGAGG - Exonic
1140343869 16:74193138-74193160 ACACACCTGTAGGTGGGGCCAGG + Intergenic
1140671769 16:77286673-77286695 CCACATCTTCAGATGGGGGCAGG - Intronic
1140966583 16:79972337-79972359 CCACATCAGCAGGAAAGGCCTGG - Intergenic
1141218178 16:82044436-82044458 CCTCACCCACAGATGGGGCCTGG + Intronic
1142126430 16:88412920-88412942 CCACAGCCACAGCCGGGGCCCGG + Intergenic
1142203251 16:88770986-88771008 TCTCATCTGCAGGCGGGGCCTGG + Intronic
1143032761 17:3976915-3976937 CCAGGTCCTCAGATGGGGCCCGG + Intergenic
1143394899 17:6585993-6586015 CCACTGCTGGAGGTGGGGCCTGG + Intronic
1143478754 17:7217246-7217268 CCACTTTTGCAGGGGGGGCCAGG + Intronic
1144777462 17:17791974-17791996 CCACCTCAGCAGGTGAGGGCTGG - Intronic
1145211990 17:21020782-21020804 CCACATCTGCAGGTGCGCCCTGG + Intronic
1146005057 17:29155716-29155738 TTCCATCCTCAGGTGGGGCCAGG - Intronic
1146065566 17:29632195-29632217 CCAGATCCTCAGGAGGGCCCAGG - Exonic
1147453187 17:40518963-40518985 CCCCATCCCCAAGTAGGGCCTGG + Intergenic
1147463800 17:40594524-40594546 CCAAATTTGGAGGTGGGGCCTGG + Intergenic
1147690811 17:42313235-42313257 CCTCACACACAGGTGGGGCCTGG - Intergenic
1147818046 17:43224344-43224366 CCACAGGCACAGGTGTGGCCAGG - Intergenic
1149587298 17:57800455-57800477 CCAACGCCGGAGGTGGGGCCTGG + Intergenic
1151530765 17:74703313-74703335 CCTCATAGGCAGGTGGGGCTGGG + Intronic
1152643714 17:81459453-81459475 ACCCATGAGCAGGTGGGGCCTGG - Intronic
1156480903 18:37435826-37435848 CCACATCCCCAGGCAGAGCCTGG + Intronic
1159902603 18:74061535-74061557 TCACATCCACAGATGGGGACAGG + Intergenic
1160291960 18:77603096-77603118 CCAGAGCCGGAGGTAGGGCCTGG - Intergenic
1160345771 18:78130654-78130676 GCACATGCCCAGGTGGAGCCAGG + Intergenic
1160394943 18:78564160-78564182 CCACCTGGGCAGGTGGGGCAAGG - Intergenic
1160734952 19:658221-658243 CCTCATCCCCGGGTGGGACCTGG + Intronic
1160939748 19:1614707-1614729 TCACATCTGCGGGTGGGGACAGG + Intronic
1160944012 19:1632886-1632908 CCACACTGGCAGGTGGGGACAGG - Intronic
1160969331 19:1760465-1760487 GCCGATCCTCAGGTGGGGCCAGG + Intronic
1161746715 19:6064612-6064634 CCCCATCCCCAGGTGGGCACAGG - Intronic
1162823618 19:13237792-13237814 CCCCATCCCCAGGTGGAGCTGGG - Intronic
1163634444 19:18431678-18431700 CGGCATCCGCAGGGTGGGCCGGG - Exonic
1164443712 19:28299735-28299757 ACACATCCCCAGAAGGGGCCGGG - Intergenic
1164940947 19:32251946-32251968 CGACATCAGCAGGAGGGACCTGG + Intergenic
1165484974 19:36090059-36090081 CTTGATCCGCAGGTGGGGTCAGG - Intronic
1167646733 19:50710090-50710112 CCCCATCTGCCTGTGGGGCCAGG + Intronic
1168240424 19:55086424-55086446 CCAGAGCTGGAGGTGGGGCCGGG - Exonic
1168310329 19:55456717-55456739 CCACATCCACACGTGGCTCCGGG + Intronic
1168687717 19:58358483-58358505 CCATACCTGGAGGTGGGGCCTGG + Exonic
1168707756 19:58479631-58479653 CCACATCCGCAGGAGGAGTGGGG + Exonic
926758323 2:16253488-16253510 CCTCATCAGCAGGTGGAGACCGG + Intergenic
928364668 2:30691813-30691835 CCACATCCCCCAGTGTGGCCTGG - Intergenic
930137579 2:47917798-47917820 ACACATCCTGTGGTGGGGCCTGG - Intergenic
931111158 2:59113138-59113160 CCAGATTTGAAGGTGGGGCCTGG + Intergenic
935360853 2:102245325-102245347 CCTCTTCCTCAGGTGGGGGCTGG - Intergenic
935964898 2:108463857-108463879 CCATATCCACAGGTGGTGCATGG + Intronic
939167374 2:138654054-138654076 CCAGTGCCGGAGGTGGGGCCTGG - Intergenic
940222407 2:151366118-151366140 CCAAATCCACAGTTGGGCCCTGG - Exonic
946253999 2:218430186-218430208 CCACATCCTGAGGTGGCCCCAGG - Intronic
946254813 2:218434729-218434751 CCCCATCCGCAAGTGGGTCCTGG + Intronic
947541972 2:230985913-230985935 CCACATCTGCAGGGTAGGCCTGG + Intergenic
948631581 2:239306402-239306424 ACACATCCGTGGATGGGGCCTGG - Intronic
948668735 2:239552744-239552766 CCAGTGCTGCAGGTGGGGCCTGG + Intergenic
948698548 2:239746605-239746627 CCACATGCCGAGGTGGGGCCTGG + Intergenic
1169131576 20:3168553-3168575 CCACAAGCGCAGGGGGAGCCAGG + Intronic
1169140324 20:3224067-3224089 CCCCACCCGCAGGTAGTGCCAGG + Intergenic
1170157037 20:13278443-13278465 CCACAGGTGCAGGTGGGGGCTGG - Intronic
1170372719 20:15667106-15667128 CCAAAGCTGGAGGTGGGGCCTGG + Intronic
1170719213 20:18860406-18860428 CCAATTTTGCAGGTGGGGCCAGG + Intergenic
1170813237 20:19691630-19691652 CCACAGCCTCCGCTGGGGCCAGG - Intronic
1171457873 20:25282155-25282177 CCACAGGCACGGGTGGGGCCCGG - Intronic
1172015590 20:31870693-31870715 CCACCTCCGGAGGTGGGGGCGGG + Exonic
1172447455 20:35000678-35000700 CTGCATTCGCAGGTGGGGACAGG + Exonic
1174037766 20:47678725-47678747 CCATATCCGCAGGTATGTCCAGG + Exonic
1175942623 20:62544915-62544937 CCAGTGCCGGAGGTGGGGCCTGG - Intergenic
1175969643 20:62677955-62677977 CCAAATCTGCAGGTGTGGCTAGG - Intronic
1176196270 20:63837485-63837507 CCACCTCCGGTGCTGGGGCCTGG + Intergenic
1178305727 21:31488743-31488765 CCACATGCCAAGATGGGGCCAGG - Intronic
1180469924 22:15644303-15644325 CCCCATCCCCAGGTCGGGCTGGG - Intergenic
1181671780 22:24428841-24428863 CCATATGCTCAGATGGGGCCAGG + Intronic
1181751482 22:24992000-24992022 CCACATCAGCATTTTGGGCCTGG + Intronic
1182355585 22:29721045-29721067 CTACGGCCGCAGGTGGGGACGGG - Intronic
1182688186 22:32136904-32136926 CCACAGCTGCAGGTGGGGGCTGG - Intergenic
1183145967 22:35992137-35992159 CAACATCCGCTGGTGTGGCAAGG - Intronic
1183279371 22:36923900-36923922 CCACATACGGAGGGGGGGCCTGG - Intronic
1183444446 22:37843933-37843955 CCCGAGCCGCCGGTGGGGCCTGG + Exonic
1184104453 22:42359434-42359456 CCACATCCTCTGGGAGGGCCAGG - Intergenic
1184357973 22:43995434-43995456 ACACAGCCGCAGCCGGGGCCAGG - Intronic
1185247605 22:49781392-49781414 CCGCCTCCCCAGGTGGGCCCTGG - Intronic
950008214 3:9704732-9704754 CCACCACTGCAGGTGGGGGCGGG - Exonic
951709563 3:25574606-25574628 GCTCATCACCAGGTGGGGCCTGG + Intronic
952910685 3:38182213-38182235 CCACATCCACAGGTCAGCCCAGG - Intronic
953289765 3:41649523-41649545 CCACAACCGGAGGAGGTGCCAGG - Intronic
954211556 3:49100369-49100391 GCTCATCCGCAGGTAAGGCCAGG - Exonic
954515258 3:51169573-51169595 CCTCATCCTCAGGTGGGCCCCGG - Intronic
954622732 3:52005199-52005221 CCAAAGCCGCAGGTGGGCACAGG - Intergenic
956745928 3:72311027-72311049 CCACCTCCGCAGGTGGACTCTGG + Intergenic
957678648 3:83403924-83403946 CCACAGCAGCAGTTTGGGCCGGG - Intergenic
960026798 3:113019470-113019492 CCACATGCGCCGGCTGGGCCTGG + Intronic
960049174 3:113224160-113224182 CCACATCCGGTGGTGGTGGCAGG + Intronic
961333492 3:126156591-126156613 CCACAGCTGCAGGAGGGGCCCGG - Intronic
961477882 3:127159834-127159856 CCACTTCCCCAGGTGGTGTCAGG - Intergenic
962574877 3:136747581-136747603 CCCCAGGCTCAGGTGGGGCCTGG - Intronic
967879388 3:194288548-194288570 CCAGTGCTGCAGGTGGGGCCTGG - Intergenic
968596967 4:1490741-1490763 GCTCATCCGCAGGAGGAGCCGGG + Intergenic
968599053 4:1500587-1500609 CCGCATCAGCAGCTGGGGACAGG + Intergenic
968629713 4:1643989-1644011 CCACATCCTCATGCCGGGCCTGG - Intronic
969357550 4:6639331-6639353 CCACACCCCAAGGTGGAGCCTGG - Intergenic
969612727 4:8236252-8236274 CCACACAGGCAGGTGGGGTCAGG - Intronic
970590110 4:17552681-17552703 CCACAGCCCCAGGTGGAGACCGG - Intergenic
970968469 4:21954131-21954153 CAACATCCTCAGGTGGTTCCAGG + Intergenic
972686588 4:41359283-41359305 CCTCACCCGCAGGCGGGACCTGG + Intergenic
983631304 4:169852362-169852384 CCACACCAGCAGAAGGGGCCAGG + Intergenic
986463567 5:7997992-7998014 TCACATCTGCAGGTGGCCCCAGG + Intergenic
987213221 5:15706170-15706192 CCAGTGCTGCAGGTGGGGCCTGG + Intronic
989499622 5:42150249-42150271 CCACATGTGGAGGAGGGGCCTGG + Intergenic
993505275 5:88701422-88701444 CCAAAGCTGGAGGTGGGGCCTGG + Intergenic
996657183 5:125954884-125954906 CCAATTCTGGAGGTGGGGCCTGG - Intergenic
997530498 5:134578769-134578791 CCACCACCGCAGGACGGGCCTGG + Exonic
999119583 5:149198761-149198783 CCTCATCCACAGGTGGGACAGGG + Intronic
1001706998 5:173748690-173748712 CCACAGCCTCAGGTGGGGGCTGG + Intergenic
1002181597 5:177433741-177433763 CCACATGGGAGGGTGGGGCCTGG - Intronic
1002763831 6:222762-222784 CCACATCCGCATGTGGGTCTGGG + Intergenic
1003160046 6:3626673-3626695 CCACATCTGCATGTGGCCCCTGG - Intergenic
1003629132 6:7770891-7770913 CCATCTCTGTAGGTGGGGCCTGG + Intronic
1003882393 6:10490440-10490462 CAGCATCTGAAGGTGGGGCCTGG - Intergenic
1005207654 6:23422754-23422776 CCACATACCAAGGTGGGGACAGG - Intergenic
1007303844 6:40889384-40889406 GAACAGCTGCAGGTGGGGCCAGG - Intergenic
1010249346 6:73692150-73692172 CCAATTTCGGAGGTGGGGCCTGG - Intergenic
1017073822 6:150600098-150600120 CCACATCCGCAGGTGGGGCCGGG + Intronic
1018808736 6:167281809-167281831 CCACATCTGCAGGTGGAGCTTGG + Intronic
1018988831 6:168658123-168658145 CCAGATCTGCAGCTGGGGCCAGG + Intronic
1019470512 7:1217943-1217965 CGACCTGTGCAGGTGGGGCCTGG + Intergenic
1019519784 7:1455409-1455431 CCACAGCCGCAGGTGAGACAGGG + Intronic
1019666640 7:2255191-2255213 CAAGATCAGCAGGCGGGGCCGGG + Intronic
1019925944 7:4191820-4191842 CCATCTCCACAGGTGTGGCCGGG + Intronic
1023930048 7:44699990-44700012 CCACTGCTGGAGGTGGGGCCTGG - Intronic
1025623196 7:63193181-63193203 CCAGATCAGCTGGTGGGGGCTGG + Intergenic
1027110512 7:75434926-75434948 CCAAATCTGCTGGTGAGGCCAGG + Intronic
1027992077 7:85375447-85375469 CCAATTCTGGAGGTGGGGCCTGG + Intergenic
1030848953 7:114458968-114458990 CTTCATCCGGAGGTGGGGCTGGG + Intronic
1033553125 7:142465510-142465532 CCAGAGCTGCAGGAGGGGCCTGG - Intergenic
1033555462 7:142484958-142484980 CCAGAGCTGCAGGAGGGGCCTGG - Intergenic
1035640257 8:1179333-1179355 CCACAGCCTCAGCTGGTGCCTGG - Intergenic
1036077857 8:5521270-5521292 CCACATCTGCAGGTGTAGGCCGG + Intergenic
1037917943 8:22784070-22784092 CCACATACGTAGGAGGAGCCTGG + Intronic
1038289644 8:26237360-26237382 CCAGTTTTGCAGGTGGGGCCTGG + Intergenic
1039531819 8:38269237-38269259 CCACCTCCGCGGGGAGGGCCGGG + Intronic
1040283869 8:46089617-46089639 GCACAGCCGCAGGTGGGACTGGG + Intergenic
1041935317 8:63326267-63326289 CCACATACCTAGGTGGGGACAGG + Intergenic
1042800143 8:72709705-72709727 CCAGGGCTGCAGGTGGGGCCTGG - Intronic
1045269467 8:100649658-100649680 GGACATCTACAGGTGGGGCCGGG + Exonic
1049219111 8:141420813-141420835 CCACGGCCGCGTGTGGGGCCAGG + Intronic
1049288471 8:141789252-141789274 GCTCATGCACAGGTGGGGCCTGG + Intergenic
1049709480 8:144057197-144057219 GCACATCCACAGGTGGGCCTGGG - Exonic
1051920818 9:22261092-22261114 CCAGTGCCGGAGGTGGGGCCTGG + Intergenic
1053049021 9:34943160-34943182 CCACATCCCTGGGTGGGTCCTGG - Intergenic
1053598343 9:39585766-39585788 GAACATCAGCAGGTGGGCCCAGG + Intergenic
1053856376 9:42342775-42342797 GAACATCAGCAGGTGGGCCCAGG + Intergenic
1056381908 9:86063382-86063404 CCTCTTCCGCAGGTGGGAGCAGG - Intronic
1057042648 9:91858530-91858552 CCAGATCTGTGGGTGGGGCCAGG + Intronic
1059605103 9:115825594-115825616 CCACTGCTGCAGTTGGGGCCTGG + Intergenic
1060529449 9:124339820-124339842 CCTCAGCCCCACGTGGGGCCTGG + Intronic
1061419527 9:130465878-130465900 CCACAGCAGCTTGTGGGGCCAGG + Intronic
1061446067 9:130638838-130638860 CCACAGCCACAGGTGAGGCTGGG - Intergenic
1061727002 9:132587540-132587562 CCAGAACCGCAGGTGAGGCCTGG + Exonic
1062152708 9:135030164-135030186 CCACATCAGGAGGAGGGGGCAGG - Intergenic
1062450769 9:136614835-136614857 GCAGCTCAGCAGGTGGGGCCGGG + Intergenic
1062601678 9:137321176-137321198 CCACAGCCTCAGGCTGGGCCTGG - Intronic
1190756321 X:53405001-53405023 CTGAATCTGCAGGTGGGGCCTGG - Exonic
1192534599 X:71916585-71916607 CCACATCAGCATGTGGTGCCTGG + Intergenic
1192786735 X:74343650-74343672 CCAATTCTGGAGGTGGGGCCTGG + Intergenic
1199334885 X:146606942-146606964 CCAATTCTGGAGGTGGGGCCTGG - Intergenic
1199373227 X:147075961-147075983 CCCCATCTGCAGGTGGGGCCTGG - Intergenic
1200152818 X:153959626-153959648 CCATTTCCACAGGTGGGGCCAGG + Intronic