ID: 1017075568

View in Genome Browser
Species Human (GRCh38)
Location 6:150614579-150614601
Sequence CTTTGACCCAATCAACTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 69}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017075568_1017075574 22 Left 1017075568 6:150614579-150614601 CCTGACAGTTGATTGGGTCAAAG 0: 1
1: 0
2: 0
3: 4
4: 69
Right 1017075574 6:150614624-150614646 CTCAACAGTGTCATCTCCCCAGG 0: 1
1: 0
2: 0
3: 17
4: 161
1017075568_1017075571 -3 Left 1017075568 6:150614579-150614601 CCTGACAGTTGATTGGGTCAAAG 0: 1
1: 0
2: 0
3: 4
4: 69
Right 1017075571 6:150614599-150614621 AAGGGCTACCAAGCAGAAGTTGG 0: 1
1: 0
2: 1
3: 11
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017075568 Original CRISPR CTTTGACCCAATCAACTGTC AGG (reversed) Intronic
905125583 1:35713998-35714020 CTTTCACCCATCCACCTGTCAGG + Exonic
907917615 1:58885355-58885377 ACATGACCCAATCACCTGTCTGG - Intergenic
909086925 1:71179512-71179534 CTTTCACCCAATGGACTATCTGG - Intergenic
910534999 1:88287633-88287655 CTGTGACCAAATCAGCTGTGTGG + Intergenic
910895652 1:92066677-92066699 CTTTGACTCAATCCCCTGTGTGG + Intergenic
911261110 1:95686909-95686931 CTTTAAACAAATTAACTGTCTGG - Intergenic
918129442 1:181612454-181612476 CTGAGAAACAATCAACTGTCAGG + Intronic
920715896 1:208339690-208339712 CTTGTACCCAATCAAGTGTTTGG + Intergenic
1064023935 10:11831676-11831698 CTAGGACCCAATCAGATGTCTGG + Intronic
1065814659 10:29473041-29473063 CTGTGACCCATTCCACTGTCTGG - Intronic
1070643515 10:78185774-78185796 CTTGGACCAGGTCAACTGTCTGG + Intergenic
1072646957 10:97263902-97263924 ATTTAACCCAATCAATGGTCAGG + Intronic
1086138878 11:83472223-83472245 CTTGTACCCAATGAACTCTCAGG - Intronic
1090042998 11:123307017-123307039 TTTTGATCCAGTCAACTTTCAGG + Intergenic
1097154463 12:57002768-57002790 CCGGGACCCAGTCAACTGTCCGG + Exonic
1104064733 12:125297309-125297331 CTGTCACCCTATCACCTGTCAGG - Intronic
1111837386 13:93405222-93405244 TTTTGACCAAATCCACTGTGTGG + Intronic
1112458152 13:99580376-99580398 CTGTGAACCACACAACTGTCAGG - Intergenic
1115823180 14:37234654-37234676 CTTTAACAAAAGCAACTGTCAGG - Intronic
1129122554 15:73409798-73409820 CTTTTACCAAATAAACAGTCAGG + Intergenic
1131731906 15:95290764-95290786 ACTTCTCCCAATCAACTGTCAGG + Intergenic
1143830040 17:9644561-9644583 CTTTATCCCATGCAACTGTCAGG - Intergenic
1146815097 17:35936199-35936221 CCTTGGTCCAATCAACTGTAGGG - Intronic
1157314202 18:46574813-46574835 CTTTGACCCAATCCCTTGTCTGG - Intronic
1158026560 18:52904743-52904765 CTTTGATCCATTCATCAGTCTGG - Intronic
1158512760 18:58106189-58106211 CACTGCCCAAATCAACTGTCAGG + Intronic
1159384133 18:67700569-67700591 CTTTTAAACAATCAGCTGTCAGG - Intergenic
1159429928 18:68338028-68338050 CTTGGACCTAATCAAGAGTCGGG - Intergenic
1162218411 19:9156091-9156113 CTTTCACCCCATCAAGTGGCAGG - Intronic
929380946 2:41352959-41352981 CTTTGACAAAAGGAACTGTCGGG - Intergenic
934097575 2:88620812-88620834 CTTTAACACAATGATCTGTCAGG + Intronic
936340359 2:111625991-111626013 ATGTGCCCCAATCACCTGTCAGG + Intergenic
939524369 2:143274654-143274676 TTGTGACCCAATCAATTGTATGG - Intronic
939955074 2:148520996-148521018 TTTTGAACCAATCAAGAGTCAGG + Intergenic
941938630 2:171009258-171009280 CTTTGTCCCATGCAACAGTCAGG + Intronic
944015898 2:195036998-195037020 CTTTGAAGCAATCCACTGTGAGG + Intergenic
944265475 2:197720377-197720399 CTTAGGCCAAATCAACTGCCTGG + Intronic
1173117336 20:40257886-40257908 CTTTCTCACAATCAACTGTGTGG + Intergenic
1184543818 22:45151426-45151448 CTTTTACCCAATGAACTCCCAGG + Intergenic
950705378 3:14776316-14776338 ATTTTTCCCAAACAACTGTCTGG - Intergenic
951518481 3:23588595-23588617 CGTTGACCCAATCAATATTCTGG + Intronic
960201012 3:114836595-114836617 GTTTGGCCTGATCAACTGTCAGG - Intronic
968280355 3:197472421-197472443 CTTTGCCCCAATGACCTGTGTGG - Intergenic
971054450 4:22896812-22896834 CTTTGGCACCATCAAATGTCAGG + Intergenic
975255449 4:72230382-72230404 CTTTAACCCAAGCAACTGGAAGG - Intergenic
977120826 4:93098954-93098976 CTTTAATACAATCATCTGTCAGG - Intronic
980626647 4:135381721-135381743 CTTTGAGCCAATTAACAGCCTGG + Intergenic
986378267 5:7156235-7156257 CATTGACCCAATCATCATTCAGG + Intergenic
989663789 5:43827628-43827650 CATTGACCCAATGACCTTTCAGG + Intergenic
992156242 5:73957777-73957799 CTTTCCCCCAATCAACTGTGTGG + Intergenic
1005457352 6:26033766-26033788 GTTTGACCCAATCCCCAGTCTGG + Intergenic
1007209727 6:40183328-40183350 TTTTGACCCAATCATCATTCAGG + Intergenic
1014172872 6:118298386-118298408 CTATGACCCATCCAACTCTCAGG + Intronic
1017075568 6:150614579-150614601 CTTTGACCCAATCAACTGTCAGG - Intronic
1021513503 7:21458991-21459013 CTATGACCCTAACAACTGACAGG + Intronic
1024015340 7:45308755-45308777 CCTTGACCCAATCATCATTCAGG + Intergenic
1030840173 7:114341804-114341826 CTTTGACTGAATCAACTTCCAGG + Intronic
1032467388 7:132154682-132154704 CTTTGACCCACCACACTGTCTGG - Intronic
1032543102 7:132720575-132720597 TTTTGATGCAAGCAACTGTCGGG - Intronic
1036465310 8:8991997-8992019 TTTTGGCCCAATCAACTGCGTGG + Intergenic
1038068071 8:23984126-23984148 TTTTGTCCCAATCAACTGGAAGG + Intergenic
1051371840 9:16365454-16365476 CTCGGACCCAATCAACACTCTGG - Intergenic
1052204040 9:25816519-25816541 CTTTGACCGAAGCAAGTGTGTGG - Intergenic
1053043313 9:34892843-34892865 CTTTAACCCAGTCAGCTGCCCGG - Intergenic
1053740935 9:41137228-41137250 CTTTGACCCAATGATCATTCAGG + Intronic
1054443923 9:65293370-65293392 CTTTGACCCAATGATCATTCAGG + Intergenic
1054486350 9:65728136-65728158 CTTTGACCCAATGATCATTCAGG - Intronic
1057807431 9:98229713-98229735 CCTTGAGACAATCAACTGTGGGG - Intronic
1060031560 9:120218787-120218809 CTTTGACCCAATCCACATCCTGG + Intergenic
1060325014 9:122605894-122605916 CTTTGGTCCAATCCAATGTCTGG - Intergenic
1185742354 X:2544011-2544033 CTTTGAACCAATCACCTGTGGGG - Intergenic
1188767175 X:34108544-34108566 CATTGACCCAATCATCATTCAGG + Intergenic
1192893515 X:75415668-75415690 CTTTGACCCTCACAACTTTCAGG - Intronic
1193858255 X:86632832-86632854 CATTGACCCAAAGAACTCTCAGG - Intronic