ID: 1017077630

View in Genome Browser
Species Human (GRCh38)
Location 6:150633443-150633465
Sequence GAGTCGCAGGTGAAGCTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 138}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017077624_1017077630 0 Left 1017077624 6:150633420-150633442 CCTGTGCATCCTGAGACTTATCC 0: 1
1: 0
2: 0
3: 10
4: 114
Right 1017077630 6:150633443-150633465 GAGTCGCAGGTGAAGCTGGTGGG 0: 1
1: 0
2: 0
3: 7
4: 138
1017077625_1017077630 -9 Left 1017077625 6:150633429-150633451 CCTGAGACTTATCCGAGTCGCAG 0: 1
1: 0
2: 0
3: 0
4: 36
Right 1017077630 6:150633443-150633465 GAGTCGCAGGTGAAGCTGGTGGG 0: 1
1: 0
2: 0
3: 7
4: 138
1017077623_1017077630 22 Left 1017077623 6:150633398-150633420 CCAGGCAGCTCAGTATTGCTGGC 0: 1
1: 0
2: 0
3: 6
4: 113
Right 1017077630 6:150633443-150633465 GAGTCGCAGGTGAAGCTGGTGGG 0: 1
1: 0
2: 0
3: 7
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017077630 Original CRISPR GAGTCGCAGGTGAAGCTGGT GGG Intronic
900241863 1:1621110-1621132 CAGTCAAAGCTGAAGCTGGTGGG + Intronic
900302576 1:1985545-1985567 GAGTGCCAGGTGAACCTGGATGG - Intronic
901904673 1:12397914-12397936 GAGGCTCAGGTGAGGATGGTAGG + Intronic
902064922 1:13677075-13677097 GTGTCGGAGGTAGAGCTGGTGGG - Intergenic
902395459 1:16130129-16130151 GCCACCCAGGTGAAGCTGGTAGG - Intronic
902686953 1:18083949-18083971 GAGTGGCAGCTGAAGCTAGAGGG + Intergenic
903271595 1:22191927-22191949 GAGTAGCGGGTGAAGCAGGAAGG + Intergenic
903383037 1:22909876-22909898 GAGAAGCAGGTGGAGATGGTGGG + Intronic
904833495 1:33320479-33320501 GAGGGGCAGGAGGAGCTGGTGGG - Intronic
907238177 1:53065470-53065492 GAGTGGCTGGCGAAGCTGGAGGG + Intronic
912470735 1:109905057-109905079 GAGTGGCTGGTGAAGCAGGGAGG - Intergenic
915604098 1:156940007-156940029 CAGGCACAGGTGAAGCTGGAGGG + Intronic
919976476 1:202616104-202616126 GAGGAGGAGGCGAAGCTGGTGGG - Intronic
919981749 1:202646218-202646240 CAGTGCCAGGTGAAGCTGGAAGG - Intronic
924731098 1:246712257-246712279 GAGTGAGAGGTGAAGCTGGCTGG + Intergenic
1064329874 10:14383479-14383501 GAGTCACTGCTGAAGCTTGTGGG + Intronic
1065139724 10:22708494-22708516 GAATTGCAGGTGATGGTGGTGGG - Intronic
1068795815 10:61078746-61078768 GAGTCCCAGGAGGAGCTTGTTGG - Intergenic
1069290586 10:66774221-66774243 GAGTCCTAGGTGAAGCAGATGGG + Intronic
1070154992 10:73827815-73827837 GGGTAGGATGTGAAGCTGGTAGG - Intronic
1070997448 10:80797984-80798006 GAGCCGGGGGAGAAGCTGGTGGG + Intergenic
1075798506 10:125137346-125137368 GAGTCCCTGGTGACTCTGGTGGG + Intronic
1077281002 11:1745412-1745434 GAGCCACAGCTGGAGCTGGTCGG + Intronic
1078382619 11:10858087-10858109 GAGTCGCTCGTGAAGATTGTAGG - Intronic
1080414946 11:32060933-32060955 GTGTCACAGGTTAAGCAGGTTGG - Intronic
1084858980 11:72005902-72005924 GAGGGGCAGGTGGAGCTGGATGG + Intronic
1089310832 11:117557169-117557191 GAGTGGGAGGTTAAGCAGGTGGG + Intronic
1099817830 12:87670717-87670739 GAGTAGCAGGTGAAGCATATAGG - Intergenic
1102471322 12:113161475-113161497 CAGCCGCAGCTGAAGCTGCTCGG + Intronic
1107768849 13:43767892-43767914 GAGTGCCAGGTGGAGCTGGAGGG - Intronic
1111821871 13:93225141-93225163 GAGTCCCAGGATAAGGTGGTAGG + Intergenic
1112474064 13:99715052-99715074 GATCCTCTGGTGAAGCTGGTGGG - Intronic
1113587788 13:111477055-111477077 GAGGCGAAGGGGAAGCTGGCAGG - Intergenic
1114515648 14:23298181-23298203 GAGTCACAGATGAAGCTCGGGGG + Exonic
1117388392 14:55239359-55239381 GAGTGGCAACTGAAACTGGTAGG - Intergenic
1120324697 14:83009534-83009556 TAGTCACAGGTGAAGTTGCTGGG - Intergenic
1120602505 14:86529153-86529175 AATTCTCAGGGGAAGCTGGTAGG - Intergenic
1121014670 14:90541338-90541360 GAGCGGCAGGTGAGGCTGGCAGG + Exonic
1123487170 15:20751745-20751767 GAGTCGTGGGAGAAGGTGGTAGG - Intergenic
1123543660 15:21320800-21320822 GAGTCGTGGGAGAAGGTGGTAGG - Intergenic
1127932434 15:63605775-63605797 CACTTGCAGGTGAAGGTGGTGGG + Intergenic
1127934490 15:63623783-63623805 GCGTGGAAGGTTAAGCTGGTTGG - Exonic
1202951977 15_KI270727v1_random:47926-47948 GAGTCGTGGGAGAAGGTGGTAGG - Intergenic
1133168336 16:3964648-3964670 GGGTGGCAGGGGCAGCTGGTGGG + Exonic
1134330753 16:13249050-13249072 GAGTCTCAGGTGCTGGTGGTTGG + Intergenic
1136631934 16:31493914-31493936 GAGACGCTGGTGAACCTGGCGGG - Exonic
1136913666 16:34162650-34162672 AAGTCGCCGCTGACGCTGGTGGG + Intergenic
1141253746 16:82382082-82382104 GAGTCCAAGGTGAAGGTGGCAGG + Intergenic
1141424345 16:83935587-83935609 TATTTGCAGGTGGAGCTGGTGGG + Intronic
1141906328 16:87029165-87029187 GAGCCTCAGCAGAAGCTGGTGGG - Intergenic
1143111702 17:4556450-4556472 GAGTGGGAGGTAAAGGTGGTGGG + Intergenic
1143477010 17:7208561-7208583 GACTCGAAGATGAAGGTGGTGGG - Intronic
1144074005 17:11700861-11700883 GAGTAGCAGGTTAAGGGGGTGGG - Intronic
1146142445 17:30379365-30379387 CGGCCCCAGGTGAAGCTGGTGGG + Exonic
1147303475 17:39547883-39547905 GAGTTAGAGGTGAAGCAGGTGGG + Intronic
1147404024 17:40197894-40197916 GAGTGAGAGGTGAAGCTGGCTGG + Intergenic
1148389450 17:47260341-47260363 GAGTTCCAGTTGAAGGTGGTGGG - Intronic
1149586353 17:57790211-57790233 GAGGCGCAGGTGGTGCTGCTTGG - Intergenic
1152234557 17:79132003-79132025 TAGGTGGAGGTGAAGCTGGTGGG - Intronic
1152664023 17:81557000-81557022 GTGTCCCAGGAGCAGCTGGTTGG + Exonic
1153433788 18:5047535-5047557 GAGTCAGAGGTGAAGCTGGCTGG + Intergenic
1157476912 18:48029441-48029463 GAGACACAGATGAAGCTGTTCGG - Exonic
1158474409 18:57767230-57767252 GAGTCGCAGACTAAGCAGGTGGG + Intronic
1160500591 18:79399725-79399747 GACTCGCAGGAGAGGCCGGTGGG + Intronic
1161720137 19:5897862-5897884 GAGGGGCTGGTGAAGCTGGGCGG - Intronic
1166345944 19:42165839-42165861 GAGTAGTAAGTGAAGGTGGTGGG + Intronic
1166356615 19:42230853-42230875 GAGTCTCAGTTAAAGCTGGAGGG + Exonic
1167842274 19:52131803-52131825 AAGTCTCATGTGATGCTGGTGGG + Intronic
1168113909 19:54210129-54210151 GAGTCGTGGGTGAAGCTGATAGG + Intronic
926001867 2:9339811-9339833 GAGAGGCAGGTGAGGCTGGAAGG - Intronic
926336514 2:11866556-11866578 GAGTGGCAGGAGAAGCAGATGGG + Intergenic
928099417 2:28427241-28427263 GAGCCACAGGTGCTGCTGGTGGG + Intergenic
931998091 2:67858067-67858089 GAGTCGCAGGTGTAGTCAGTTGG + Intergenic
934660101 2:96138671-96138693 GGGCTGCAGGTGGAGCTGGTTGG - Intergenic
937077593 2:119118180-119118202 GGGTGGCAAGTGAAGCTGTTTGG - Intergenic
937139375 2:119586149-119586171 GAGTCAAAGATGAAGCTGGCTGG + Intronic
938125132 2:128665564-128665586 GAGCTTCAGGTGCAGCTGGTCGG + Intergenic
939776348 2:146392498-146392520 GGGTCGCGGGTGAAGTTGGGGGG - Intergenic
942498886 2:176567445-176567467 GAGTTGGATATGAAGCTGGTGGG + Intergenic
945600084 2:211850727-211850749 GAGTGGCAGATGAGGCTGTTAGG + Intronic
947745723 2:232506436-232506458 GAGGCCCAGATGAAGGTGGTGGG + Intergenic
948026946 2:234785935-234785957 GAGTCACAGGTGAACTAGGTTGG + Intergenic
948469002 2:238165541-238165563 GTGTCGTAGGTGAAGTTGGTGGG + Intronic
948742237 2:240055633-240055655 GAGGGGCTGGTGAAGGTGGTGGG + Intergenic
1168761024 20:349526-349548 GAGTGGGAGGAGAAGCGGGTGGG + Intronic
1171810398 20:29741943-29741965 GTGTCGCAGCTGACGCCGGTGGG - Intergenic
1172651047 20:36501620-36501642 GAGCCACAGGTGAACCAGGTGGG - Intronic
1172940261 20:38649249-38649271 GAGTTGCAGATGCTGCTGGTCGG + Intronic
1173964087 20:47098686-47098708 GAGTTGGAGGTGAAGGTGGCTGG - Intronic
1174392163 20:50224370-50224392 GGGTCGCAGGTGGGGGTGGTGGG + Intergenic
1175550458 20:59814060-59814082 GAGGCGCTGGCTAAGCTGGTGGG + Intronic
1175985318 20:62761530-62761552 CAGTCCCAGGAGAAGCTGGCCGG + Exonic
1180599777 22:17008242-17008264 GGGTCAGAGGTGAAGCTCGTGGG + Intergenic
1181639158 22:24187802-24187824 GCGACGCTGGTGCAGCTGGTGGG - Exonic
1184747303 22:46463814-46463836 TAGTCGCCGGTGAAGCCGGGCGG + Exonic
950014706 3:9747461-9747483 CAGTCTCAGGGGAAGCTGGGTGG + Exonic
954749662 3:52806398-52806420 CAGTCACAGGTGAGGCTTGTGGG + Exonic
956321447 3:68001137-68001159 GAAAAGGAGGTGAAGCTGGTGGG + Intergenic
956547611 3:70422264-70422286 GAGGTGAAGGTGAAGTTGGTGGG - Intergenic
958049279 3:88323739-88323761 GTGTCGAAGGGGAACCTGGTGGG + Intergenic
977835274 4:101638411-101638433 GAGTGACAGGTGAAACTGGCTGG - Intronic
982176534 4:152710317-152710339 GAGGAGCAGTTGAAGCTGGTGGG - Intronic
983207982 4:164931156-164931178 CATTGGCAGGAGAAGCTGGTGGG + Intergenic
989172088 5:38481985-38482007 CAGCCGCAGATGAAGCTGGAGGG - Exonic
989314159 5:40057450-40057472 GATTCCCAGGGGAAGATGGTGGG - Intergenic
1006779950 6:36625676-36625698 GAGGGGCAGCTGGAGCTGGTAGG + Intergenic
1012680974 6:102178688-102178710 AAATCACAGGTGAAACTGGTTGG + Intergenic
1014296764 6:119627964-119627986 GAGTAGGAGCTGAAGCTGGAAGG + Intergenic
1014623199 6:123694904-123694926 GAGGGGCAGGTGAAGCTAGAAGG + Intergenic
1015329556 6:131961649-131961671 GTGTTGGAGGTGGAGCTGGTGGG + Intergenic
1017077630 6:150633443-150633465 GAGTCGCAGGTGAAGCTGGTGGG + Intronic
1019898780 7:4003358-4003380 GTGTCACAGGGGAAGCTGGGTGG - Intronic
1023752650 7:43386667-43386689 GTGACACAGCTGAAGCTGGTGGG - Intronic
1025834268 7:65080788-65080810 CAGTCAGAGGTCAAGCTGGTGGG + Intergenic
1026989504 7:74575726-74575748 AAGATGCAGGAGAAGCTGGTGGG + Intronic
1028638907 7:93021601-93021623 GAGAGGCAGGTAAAGCTGGGTGG + Intergenic
1030084175 7:105803114-105803136 GAGTCTCAGTTGAAGTTGGCTGG - Intronic
1030102689 7:105960517-105960539 GGGTCTCATGTGAAGCTGGAGGG + Intronic
1033124823 7:138698348-138698370 GAGATGCAGGTGAAGGTTGTTGG + Intronic
1033313664 7:140280673-140280695 GGGTTGCAGGTGAAGATGGTGGG - Intergenic
1033781808 7:144680139-144680161 GTGTGGCAGGTGAGGCTGTTGGG - Intronic
1034986118 7:155516560-155516582 GAGTCACAGGCTAAGCTGGATGG + Intronic
1035708741 8:1696604-1696626 GAGGCACAGGTGACGCTGCTGGG - Intronic
1038885851 8:31662484-31662506 GAGTGGCAGGTGCACCTGGTAGG - Intronic
1041840134 8:62259870-62259892 GAGACGAAGGTGAAGGTGGGTGG + Intronic
1043690062 8:83140253-83140275 AAGTGAGAGGTGAAGCTGGTTGG - Intergenic
1045010255 8:97952586-97952608 GAGTCTCTGGGGAAACTGGTTGG + Intronic
1045937461 8:107697347-107697369 AAGTCCCAGGAGAAGCAGGTTGG - Intergenic
1047898842 8:129397690-129397712 GAGTCACAGGTGGTGGTGGTGGG - Intergenic
1047968161 8:130062660-130062682 GAGCTGCAGGTGAAGAGGGTGGG - Intronic
1048860877 8:138723906-138723928 GAGGCGGAGGTGAAGCAGATTGG - Intronic
1049622401 8:143604634-143604656 GAGGCCCAGGTGAATCTTGTGGG + Exonic
1051272092 9:15365532-15365554 GTGTCTGAGGTGAAGCTGGCTGG - Intergenic
1053120834 9:35546613-35546635 GAGGGGCAGGTGGAGGTGGTGGG + Exonic
1057911855 9:99025797-99025819 GGGAGGCAGGTGAGGCTGGTGGG - Intronic
1060528351 9:124333080-124333102 GAGTCGTCGGGGAAGCTGGCAGG - Intronic
1060896184 9:127219034-127219056 TAGTCGCAGATGCAGGTGGTGGG - Exonic
1062144948 9:134983897-134983919 GAGTCACAGGGACAGCTGGTCGG - Intergenic
1203793400 EBV:163405-163427 GAGTCGTAGTTGAGGCTGGCCGG + Intergenic
1187393909 X:18903900-18903922 GAGTTTCAGGTGATGCTGGGAGG - Intronic
1187446994 X:19369086-19369108 GAGGCTCAGGTGCTGCTGGTGGG + Exonic
1188114075 X:26222802-26222824 GAGTCTCAGGAGAATCTGGTGGG + Intergenic
1190517266 X:51236390-51236412 CAGTTGCAGGTCAAGCAGGTGGG - Intergenic
1197048030 X:122023937-122023959 GAATAGCAGCTGAAACTGGTTGG - Intergenic
1199530864 X:148846221-148846243 GAGTTCCAGCTGAAGCAGGTAGG - Intronic
1200164686 X:154027804-154027826 GAGTCAGAAGTGAAGCTGGGGGG + Intronic