ID: 1017079499 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:150654192-150654214 |
| Sequence | GTCCAGGCACCGGGTGCTGA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 197 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 18, 4: 178} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1017079492_1017079499 | 16 | Left | 1017079492 | 6:150654153-150654175 | CCGGGCGGCAGAAAGATGCACAT | No data | ||
| Right | 1017079499 | 6:150654192-150654214 | GTCCAGGCACCGGGTGCTGAGGG | 0: 1 1: 0 2: 0 3: 18 4: 178 |
||||
| 1017079491_1017079499 | 17 | Left | 1017079491 | 6:150654152-150654174 | CCCGGGCGGCAGAAAGATGCACA | 0: 1 1: 0 2: 0 3: 11 4: 152 |
||
| Right | 1017079499 | 6:150654192-150654214 | GTCCAGGCACCGGGTGCTGAGGG | 0: 1 1: 0 2: 0 3: 18 4: 178 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1017079499 | Original CRISPR | GTCCAGGCACCGGGTGCTGA GGG | Intronic | ||