ID: 1017079499

View in Genome Browser
Species Human (GRCh38)
Location 6:150654192-150654214
Sequence GTCCAGGCACCGGGTGCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 178}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017079492_1017079499 16 Left 1017079492 6:150654153-150654175 CCGGGCGGCAGAAAGATGCACAT No data
Right 1017079499 6:150654192-150654214 GTCCAGGCACCGGGTGCTGAGGG 0: 1
1: 0
2: 0
3: 18
4: 178
1017079491_1017079499 17 Left 1017079491 6:150654152-150654174 CCCGGGCGGCAGAAAGATGCACA 0: 1
1: 0
2: 0
3: 11
4: 152
Right 1017079499 6:150654192-150654214 GTCCAGGCACCGGGTGCTGAGGG 0: 1
1: 0
2: 0
3: 18
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017079499 Original CRISPR GTCCAGGCACCGGGTGCTGA GGG Intronic