ID: 1017081409

View in Genome Browser
Species Human (GRCh38)
Location 6:150672422-150672444
Sequence GCATTTATATTGTTTGATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 228}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017081399_1017081409 25 Left 1017081399 6:150672374-150672396 CCTCTGCTTTCCTCGATGTCCCG 0: 1
1: 0
2: 0
3: 5
4: 148
Right 1017081409 6:150672422-150672444 GCATTTATATTGTTTGATCATGG 0: 1
1: 0
2: 2
3: 20
4: 228
1017081405_1017081409 5 Left 1017081405 6:150672394-150672416 CCGTTAAGTTCCCAGGGGAAGCC 0: 1
1: 0
2: 2
3: 10
4: 147
Right 1017081409 6:150672422-150672444 GCATTTATATTGTTTGATCATGG 0: 1
1: 0
2: 2
3: 20
4: 228
1017081407_1017081409 -6 Left 1017081407 6:150672405-150672427 CCAGGGGAAGCCAGACAGCATTT 0: 1
1: 0
2: 1
3: 23
4: 189
Right 1017081409 6:150672422-150672444 GCATTTATATTGTTTGATCATGG 0: 1
1: 0
2: 2
3: 20
4: 228
1017081406_1017081409 -5 Left 1017081406 6:150672404-150672426 CCCAGGGGAAGCCAGACAGCATT 0: 1
1: 0
2: 1
3: 24
4: 252
Right 1017081409 6:150672422-150672444 GCATTTATATTGTTTGATCATGG 0: 1
1: 0
2: 2
3: 20
4: 228
1017081404_1017081409 6 Left 1017081404 6:150672393-150672415 CCCGTTAAGTTCCCAGGGGAAGC 0: 1
1: 0
2: 0
3: 20
4: 112
Right 1017081409 6:150672422-150672444 GCATTTATATTGTTTGATCATGG 0: 1
1: 0
2: 2
3: 20
4: 228
1017081398_1017081409 28 Left 1017081398 6:150672371-150672393 CCTCCTCTGCTTTCCTCGATGTC 0: 1
1: 0
2: 0
3: 22
4: 293
Right 1017081409 6:150672422-150672444 GCATTTATATTGTTTGATCATGG 0: 1
1: 0
2: 2
3: 20
4: 228
1017081400_1017081409 15 Left 1017081400 6:150672384-150672406 CCTCGATGTCCCGTTAAGTTCCC 0: 1
1: 0
2: 0
3: 4
4: 24
Right 1017081409 6:150672422-150672444 GCATTTATATTGTTTGATCATGG 0: 1
1: 0
2: 2
3: 20
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017081409 Original CRISPR GCATTTATATTGTTTGATCA TGG Intronic
905812286 1:40921553-40921575 GCCTTTACATAATTTGATCATGG + Intergenic
907738894 1:57143958-57143980 TCATATATATTGTTAGATGAAGG + Intronic
908940067 1:69421412-69421434 GCATTTATTCTGTTAGATAAAGG - Intergenic
908952640 1:69580031-69580053 GCATTTAGAGTGATTGTTCATGG - Intronic
909924669 1:81425667-81425689 GGATTTATATTTTTTAACCAAGG - Intronic
909960872 1:81840537-81840559 GCATTTTTAAAGTTTGAACATGG + Intronic
910073455 1:83247235-83247257 AAATTTATACTGGTTGATCATGG - Intergenic
910652556 1:89585429-89585451 TCATTTATTTTGTTTTTTCATGG - Intronic
910697838 1:90040349-90040371 ACATATATATGGTTTAATCAAGG - Intergenic
916433271 1:164752851-164752873 ACATGTATATTTTTTGCTCATGG + Intronic
918724401 1:187899819-187899841 GAAATTATCTTGTTTGATCACGG - Intergenic
920569745 1:207007714-207007736 GCATTTGTTTTGTTTGTTTATGG + Intronic
921016323 1:211195333-211195355 GCACTCATAATGGTTGATCAGGG - Intergenic
921174788 1:212584614-212584636 GCATTTAAACTGATGGATCAAGG - Intronic
921443631 1:215218564-215218586 GCATTTACATGCTTTGTTCATGG - Intronic
921575323 1:216828868-216828890 GTATTTATAATAATTGATCATGG + Intronic
923280929 1:232442152-232442174 GCAGGTACATTGTTTGATCCTGG - Intronic
1068101749 10:52563281-52563303 GCATTTATATTTTTACATCAGGG - Intergenic
1068572504 10:58645589-58645611 CCATTTATATTTTGTGATCCTGG + Intronic
1077720333 11:4621754-4621776 GCATTTGTCTTCTTTGAACATGG - Intergenic
1077760067 11:5085579-5085601 GCATTTATGATGTGTGATAAAGG + Intergenic
1078742848 11:14084106-14084128 TCATTTTTATTGTTTTTTCAAGG + Intronic
1078805805 11:14701736-14701758 GTATTTATATTACTTGATTATGG + Intronic
1079839784 11:25382494-25382516 GCTTTTATATTCTTTGATACTGG + Intergenic
1080118624 11:28648516-28648538 GCTTTTATGTTTTTTGAACAAGG + Intergenic
1080471352 11:32548652-32548674 AAATTTTTATTGTTTGATCAAGG + Intergenic
1080863314 11:36169813-36169835 GCAGTGAGATTGTTGGATCATGG + Intronic
1081304418 11:41494102-41494124 GCATTTCTATGGTTTTACCAGGG - Intergenic
1086984892 11:93237034-93237056 GTGTTTACATTGTTTGTTCAAGG + Intergenic
1089326246 11:117659525-117659547 ACATTTTTATTGTTTAAGCACGG + Intronic
1094018784 12:25892204-25892226 GCATTTATATTAATTGAATAAGG - Intergenic
1096014971 12:48262561-48262583 AGATTTATTTTGTTAGATCAAGG + Intergenic
1096439832 12:51631637-51631659 TATTTTATTTTGTTTGATCAAGG - Intronic
1096751578 12:53762321-53762343 GCATATTTATTGATTGATAAAGG + Intergenic
1098295301 12:68998157-68998179 GCATTTACCTTATTTGAACATGG - Intergenic
1099802243 12:87471998-87472020 GCATTTCTCATATTTGATCATGG - Intergenic
1100203096 12:92320126-92320148 GTATTTTTATTTTTTGATTATGG + Intergenic
1101681576 12:106972613-106972635 GGATTTGAATTGTTTGATTATGG + Exonic
1102732207 12:115121468-115121490 GCATTTTTATTGTCTGACCTGGG - Intergenic
1104936932 12:132370061-132370083 GCATTTGTCTTATTTGAACACGG - Intergenic
1106021300 13:25918443-25918465 GCTTTTTTCTTGTTTAATCATGG - Intronic
1107106674 13:36650561-36650583 TCATTTATATTGCTTCATCAAGG - Intergenic
1107537816 13:41352842-41352864 GTATTTATATTCTTTTATGAAGG + Intronic
1107654579 13:42578513-42578535 TCATTTATTTTGTTTACTCAAGG - Intronic
1107704737 13:43090274-43090296 ACATTTACCTTGTTTGAGCATGG + Intronic
1109338575 13:61025324-61025346 GAAAATACATTGTTTGATCAGGG - Intergenic
1110703627 13:78579037-78579059 GAATTTATATAATTTGCTCAAGG + Intergenic
1111255365 13:85660842-85660864 GCATTTGTCTTATTTGGTCATGG + Intergenic
1111383417 13:87490819-87490841 CTATTAATATTGTTAGATCAGGG + Intergenic
1112528132 13:100172563-100172585 GCTTTTAAATGGTATGATCAAGG - Intronic
1112964069 13:105165382-105165404 GCATTTATAGTGATTAATAATGG - Intergenic
1113111798 13:106831357-106831379 GCATTTACATTTTCTAATCAAGG + Intergenic
1114166899 14:20228239-20228261 ACATATATAGTATTTGATCAAGG - Intergenic
1115235309 14:31203722-31203744 TCATTTAAATTGTTTTAACATGG + Intronic
1115368414 14:32584428-32584450 GCATTTATATTTTCAGACCATGG + Intronic
1115874726 14:37847464-37847486 GCATTTCTATAGTTTGGTCATGG + Intronic
1115908371 14:38227128-38227150 GCATTTACCTTATTTGAACATGG - Intergenic
1115976161 14:38999420-38999442 GCATTTGCCTTGTTTGAACATGG + Intergenic
1116337377 14:43674361-43674383 GCATTTATATTGTTTTATTATGG - Intergenic
1116501766 14:45632706-45632728 GCATTTATCTTATTTGAACATGG - Intergenic
1119893513 14:78200831-78200853 GGAGATCTATTGTTTGATCATGG + Intergenic
1119897808 14:78234790-78234812 TCATTTATTTTGTTTAACCATGG - Intergenic
1123807892 15:23894240-23894262 ACATTTACCTTGTTTTATCAAGG - Intergenic
1124682991 15:31753027-31753049 TCATTTTTACTGTTTCATCAGGG + Intronic
1127844256 15:62855986-62856008 GCATTTACACTGTGTGAACACGG + Intergenic
1129554680 15:76494997-76495019 TCATTTATATAGTGTGATAATGG + Intronic
1129555054 15:76499302-76499324 TCATTTATATAGTGTGATAATGG + Intronic
1131044380 15:89301667-89301689 GCTTTTGTTTTGTTTGTTCAGGG + Intronic
1134627350 16:15731794-15731816 CTATTTTTATTGTTTGATTAAGG + Intronic
1135169456 16:20170400-20170422 TCTTTTACATTGTTTGATGAAGG + Intergenic
1135248318 16:20877337-20877359 GCATTTGGATTGGTTGAACATGG - Intronic
1136635560 16:31520350-31520372 GCATTTATCTTATTTGAACATGG - Intergenic
1137243963 16:46687963-46687985 ACATTTATATTGTTTTGTAATGG - Intronic
1137510640 16:49096883-49096905 TCATTCATCTTATTTGATCAGGG - Intergenic
1137666508 16:50252669-50252691 GCATTGCTATTGCTTGGTCATGG - Intronic
1138730639 16:59190228-59190250 GCATTTATAGGGTAGGATCATGG + Intergenic
1140604582 16:76519084-76519106 CCATTAACATTATTTGATCATGG + Intronic
1140969146 16:79996157-79996179 GCATCTTTTTTGTTGGATCAAGG - Intergenic
1141384504 16:83607057-83607079 GCATTTATAGTGTTTGTTTAAGG + Intronic
1144455332 17:15413767-15413789 GCATTTATTTTTTGTAATCATGG - Intergenic
1148924135 17:51067164-51067186 GAATTTGTATTATTTGATCTTGG - Intronic
1151031130 17:70741003-70741025 ATATTTATATTCTTTAATCAGGG - Intergenic
1155772299 18:29717291-29717313 GCATTAATAGTCTTTGTTCAGGG - Intergenic
1157147192 18:45175796-45175818 GGGGTTATATTGTTTGTTCAGGG + Intergenic
1157686699 18:49648525-49648547 GCATTTAAATTGTTTACGCAGGG + Intergenic
1157929637 18:51807456-51807478 GCATTTGTCTTATTTGAGCATGG - Intergenic
1158157090 18:54438239-54438261 GCATGTATATCATTTCATCATGG - Intergenic
1159910680 18:74143016-74143038 GAATTGTTATTGTTTGATGAAGG - Intronic
1162266498 19:9579858-9579880 GCATTTATATTATCAAATCAGGG - Intronic
1166610054 19:44183436-44183458 GCATTTATAGTGTTTGTCCTTGG - Intergenic
1167480599 19:49728357-49728379 GCCTATATAATGTTTGAGCAGGG + Intergenic
1168647441 19:58069064-58069086 GTGTGTATATTGTTTGATCAGGG + Exonic
925407994 2:3619601-3619623 GCATAAATTTTGCTTGATCATGG + Intronic
925946247 2:8866578-8866600 TTATTAATTTTGTTTGATCATGG - Intronic
926664093 2:15500961-15500983 TTATTTATATTCTTTTATCAAGG - Intronic
928575627 2:32651882-32651904 TCATTTATGTTGTTTGTTCCAGG + Intronic
931032444 2:58194117-58194139 GTCTTTATATTTTTTTATCATGG - Intronic
933350896 2:81151021-81151043 GCCTATATTTCGTTTGATCAGGG - Intergenic
935263828 2:101377991-101378013 TCATATATATTGTGTGAGCATGG + Intronic
936863566 2:117052023-117052045 GCTATTATATAGTTTGATAAAGG - Intergenic
937804084 2:126117298-126117320 TGATGTAAATTGTTTGATCATGG - Intergenic
940123478 2:150294898-150294920 GGATTTATATTTTTGGCTCAAGG - Intergenic
942063547 2:172249507-172249529 GCATTTGTCTTGTTTGGACATGG - Intergenic
942789549 2:179744196-179744218 TCCTTTATATTGTTTAATCCAGG - Intronic
942865415 2:180667687-180667709 GTAATTCTATTGTTTGACCAGGG + Intergenic
943139842 2:183968504-183968526 GCATTTAAATAGATTGATAATGG + Intergenic
943211998 2:184978582-184978604 GCATTGATATTCTTTGGTCATGG + Intergenic
943612365 2:190048093-190048115 GCATTTATCTGATTTGATTATGG + Intronic
944721299 2:202425394-202425416 GCATTTGTCTTATTTGAACATGG + Intronic
945665997 2:212743629-212743651 GCATTTTTATGATCTGATCATGG - Intergenic
946789170 2:223283215-223283237 GCATTTACCTTATTTGAACAGGG + Intergenic
947255587 2:228160207-228160229 ACATTTAAATTGTATAATCATGG - Intronic
1169838628 20:9908916-9908938 ACATTTAAATTTTGTGATCAAGG + Intergenic
1169947614 20:11006226-11006248 ACATTTCTGTTGTTTTATCATGG - Intergenic
1170350176 20:15431314-15431336 ACATCTATTTTGTTTGATAATGG - Intronic
1176360413 21:5991351-5991373 GCATAAATCTTTTTTGATCATGG + Intergenic
1177398710 21:20572912-20572934 GCATTTAAATTCTATGATTAGGG + Intergenic
1177510498 21:22080848-22080870 TCACTTATATTATTTGAACAAGG - Intergenic
1177586930 21:23109161-23109183 GCATTTATAATTTTTTATTAAGG - Intergenic
1177948855 21:27508236-27508258 GCTTTTTTATTGTTTGAAAAAGG + Intergenic
1178014165 21:28323905-28323927 GCATTTTTAGTGGTTGCTCAAGG + Intergenic
1178665069 21:34539280-34539302 GCATGTATATTATCTGATCACGG - Intronic
1179763105 21:43547199-43547221 GCATAAATCTTTTTTGATCATGG - Intronic
1181324659 22:22035446-22035468 GAATTTATTTTCTTGGATCATGG - Intergenic
1181660033 22:24339727-24339749 GCATTTATATTGTGAGTTCGTGG + Intronic
949354257 3:3161419-3161441 TTATTTTTATTGTTTCATCATGG - Intronic
949735972 3:7172082-7172104 CCATGTATATTGTTTTAGCACGG + Intronic
950953089 3:17022087-17022109 GCATTTTTATTGTTTTTTAAAGG + Intronic
956007201 3:64792825-64792847 GCTTTTATAATGTTAGCTCACGG - Intergenic
956193075 3:66625546-66625568 GGATTTTTATTTTTTAATCAAGG + Intergenic
957255440 3:77830318-77830340 TACTTTATATTATTTGATCATGG - Intergenic
957320336 3:78622339-78622361 ACATTTATATTTATTGATAAGGG - Intronic
957509742 3:81171887-81171909 GCATTTAACTTGATAGATCAGGG - Intergenic
957827772 3:85470981-85471003 GCAGATTTATTGTTTAATCATGG + Intronic
958066309 3:88548424-88548446 GCATTTATATTATTTGCCCATGG + Intergenic
958740054 3:98058219-98058241 GGATTTTTATGGTTTGTTCATGG - Intergenic
959349569 3:105244528-105244550 TCATTCAGATTGTTTGATCTAGG - Intergenic
959765701 3:110024808-110024830 GTTTTTTTATTTTTTGATCACGG - Intergenic
962543554 3:136408845-136408867 GTTTTTATATAGTATGATCAAGG + Intronic
963224851 3:142851769-142851791 GCTTTTAGATTATTTCATCAAGG + Intronic
963262602 3:143207810-143207832 CCATTTATACTGTTTGACCTTGG + Intergenic
963767295 3:149350829-149350851 GCATTTGCATTATTTGAACATGG - Intergenic
964826177 3:160830348-160830370 GCATGTATATAGTTCCATCATGG + Intronic
965222286 3:165941611-165941633 GTATTTATATTATATGATCCAGG + Intergenic
965310576 3:167122643-167122665 GCATTTACTGTGTTTGATAATGG - Intergenic
965994697 3:174866618-174866640 GCATTTATTTTGGTTAATGAAGG + Intronic
968388940 4:172655-172677 TCATTTATTTTGTTTGAAGAAGG - Intergenic
970271157 4:14349084-14349106 GAAGTTATATTATTTGTTCAAGG + Intergenic
970578301 4:17448983-17449005 GCATTTACCTTATTTGAACACGG + Intergenic
971728758 4:30349109-30349131 GCATTTGTCTTATTTGAACAGGG - Intergenic
971937235 4:33167438-33167460 GAATTTATTTTGTATGATAAAGG - Intergenic
973018909 4:45174580-45174602 GCATCTTTATTGTTAGAACAAGG - Intergenic
973059635 4:45705671-45705693 GCATGACTAATGTTTGATCAAGG - Intergenic
973150860 4:46886672-46886694 ACATTTTTATTTTTTAATCAGGG - Intronic
977779582 4:100965095-100965117 GCATGAATATTGCTTCATCAAGG - Intergenic
977805279 4:101290466-101290488 GTATTTATATTATTTAAGCAAGG - Intronic
978791062 4:112663971-112663993 GCAGGAATATTGTTTGATCCTGG + Intergenic
980228290 4:130015611-130015633 GCAGTTAAATTGCCTGATCAAGG - Intergenic
980444884 4:132892110-132892132 ACCTTTATAATGTTTTATCATGG - Intergenic
980480228 4:133378216-133378238 CAATTTATTTTGTTTGTTCAGGG - Intergenic
980486889 4:133469679-133469701 GCATTTGTGTTATTTGAACACGG - Intergenic
982041215 4:151398899-151398921 ACATTTATATTAATTGATTATGG + Intergenic
982495043 4:156080431-156080453 ACATTTATTTTGTTTGATAATGG + Intergenic
985932799 5:3072318-3072340 ACATTAATACTGTTGGATCAGGG - Intergenic
987960091 5:24795764-24795786 GGATTTATATTCTTTAATCTGGG - Intergenic
988107016 5:26764251-26764273 TCATTTATATTGTTAGAGTAAGG - Intergenic
988384852 5:30549268-30549290 TCATTTATATTATTTTATCTTGG - Intergenic
988861370 5:35283798-35283820 GCATTTGTATTGTTTAACCATGG + Intergenic
989483443 5:41960646-41960668 TCACATTTATTGTTTGATCATGG + Intergenic
990599148 5:57339897-57339919 GAATTTATAATGTGTGTTCATGG + Intergenic
992178090 5:74170613-74170635 GCATTTTTATTATGTGAGCAGGG - Intergenic
992772825 5:80064447-80064469 GCATTTATCATGTTTCCTCATGG - Intronic
993303517 5:86244800-86244822 GTATTTATATTGTGTAATTATGG + Intergenic
993832699 5:92779153-92779175 GCATTAATTTTGGGTGATCATGG + Intergenic
994536771 5:101040692-101040714 GCACTGCTATAGTTTGATCATGG - Intergenic
994844580 5:104971042-104971064 GCATTTATTTTATTTTATCTTGG + Intergenic
995319688 5:110819662-110819684 GCATTTTTATGCTTTTATCAGGG - Intergenic
1000746398 5:165039495-165039517 TTATTTATATTTTTTTATCATGG - Intergenic
1000789474 5:165587607-165587629 ACATTTTTATTGTTTGCTTAAGG + Intergenic
1001007583 5:168067388-168067410 GCATTTATTTGGTATGATCATGG - Intronic
1001766949 5:174257094-174257116 ACATATATATTTTTTAATCATGG - Intergenic
1004460353 6:15829413-15829435 GCATTTGCCTTGTTTGAACATGG + Intergenic
1006482011 6:34303035-34303057 GCATTTATATGGATGGATAAAGG - Intronic
1008659072 6:53646859-53646881 GCATTGTTATGGTGTGATCAGGG + Intergenic
1008689647 6:53963514-53963536 GCATGAATAGTGTTTGATCAGGG - Intronic
1008743082 6:54633760-54633782 GGATTTAAAATGTCTGATCAGGG - Intergenic
1010582794 6:77620060-77620082 GGACTTATATTGTTGGGTCAGGG + Intergenic
1011561786 6:88626099-88626121 GGAGTTATATAATTTGATCAGGG + Intronic
1011736328 6:90314039-90314061 GCATTCATAGTTTTTGAGCACGG + Intergenic
1011954437 6:93008437-93008459 GCATTTACCTTATTTGAACATGG - Intergenic
1012910139 6:105108966-105108988 ACATTTATTTTTTTTGAGCAGGG + Intronic
1014021701 6:116598344-116598366 GCATTTTTGTTGTTTGAGTATGG + Intergenic
1015006385 6:128286687-128286709 GATTTTATATTGTTTGATGCTGG + Intronic
1015587092 6:134787383-134787405 GGATTTACATTGTTTGAAGATGG - Intergenic
1016174109 6:141056602-141056624 TCATTTATTTTGTATGATAATGG + Intergenic
1016227750 6:141760784-141760806 GGAATTATATTTTTTGATCTGGG - Intergenic
1017053931 6:150420965-150420987 GCATTTACCTTATTTGAACATGG - Intergenic
1017081409 6:150672422-150672444 GCATTTATATTGTTTGATCATGG + Intronic
1017737303 6:157377070-157377092 GCATTTGTCTTATTTGAACATGG + Intergenic
1022610826 7:31870830-31870852 GAATTTATGTAGTGTGATCAAGG - Intronic
1023397062 7:39761140-39761162 GCTTTTGTATTGTTCCATCAGGG - Intergenic
1023566710 7:41530410-41530432 GTTTTTATATTGTGTGATTATGG + Intergenic
1027291137 7:76712109-76712131 AAATTTATACTGGTTGATCATGG - Intergenic
1027709357 7:81579094-81579116 GCATTTATGTTATTTGATTTTGG - Intergenic
1027725328 7:81798224-81798246 GAAGTTAAATGGTTTGATCAAGG - Intergenic
1030803672 7:113887338-113887360 TCATCTATATTATTTAATCATGG + Intronic
1031832853 7:126648647-126648669 GCATTTATGCTTTTGGATCAGGG + Intronic
1033761049 7:144437160-144437182 GCATTTCTGTAGTTTGCTCAAGG + Intergenic
1035411339 7:158645151-158645173 GAATTTATTTTGGTTGATGACGG - Intronic
1035904828 8:3498259-3498281 GTATTTATATTGCTATATCAAGG + Intronic
1038302945 8:26371929-26371951 GCATTTATATTATTAGAGAATGG + Intronic
1041231341 8:55756345-55756367 GCACTTATAATTTTTTATCATGG - Exonic
1041474678 8:58249969-58249991 GCTTTTGTAATGTTTTATCATGG - Intergenic
1042103712 8:65301364-65301386 GCATTTATATAGGATGATTAAGG + Intergenic
1042464362 8:69110324-69110346 TAATTCATATTATTTGATCAAGG + Intergenic
1042699911 8:71600988-71601010 GTATTTATACTGTTTCTTCAAGG - Intergenic
1043065038 8:75558649-75558671 GCAATTGTATTTTTTGATCCAGG + Exonic
1043304853 8:78782106-78782128 GCTTCTATAATGTTTTATCATGG + Intronic
1043348908 8:79335407-79335429 TTATTTTTATTTTTTGATCATGG - Intergenic
1044429216 8:92089150-92089172 GCATTCTTCTGGTTTGATCAAGG - Intronic
1044740952 8:95325932-95325954 GGTTTTATATAGTTTGATCATGG + Intergenic
1046579223 8:116071010-116071032 GGAATTATATTATTTGAACAGGG + Intergenic
1046638606 8:116700667-116700689 AGATTTATATAGTTTGATCAGGG + Intronic
1050264454 9:3875336-3875358 GCATTTATTTTATTTTATGATGG + Intronic
1053534955 9:38916166-38916188 GCATTTACCTTATTTGAACATGG - Intergenic
1054207173 9:62140588-62140610 GCATTTACCTTATTTGAACATGG - Intergenic
1054631178 9:67447766-67447788 GCATTTACCTTATTTGAACATGG + Intergenic
1054842382 9:69757319-69757341 GCATTTATATAGTATTATCCAGG + Intronic
1055122731 9:72681275-72681297 GCATTTAGATTGTTTGAGGGAGG - Intronic
1055430299 9:76236806-76236828 CCATTTTTATTGTTTGGACATGG - Intronic
1056490968 9:87106794-87106816 GTAGTTAGATTGTTTGATCAAGG - Intergenic
1056566074 9:87773401-87773423 GCTTTTTTATTCTTTTATCATGG + Intergenic
1057113161 9:92493540-92493562 CCATTAATATTTTTAGATCATGG + Intronic
1058465128 9:105219595-105219617 TTATTTATATTGTATGTTCAAGG + Intergenic
1060867904 9:127014371-127014393 GCATTTGTACTGTCTGATGATGG - Intronic
1186013025 X:5158444-5158466 GCAGTTGGATTGTTGGATCATGG - Intergenic
1186703505 X:12117169-12117191 GCATGTATATCGTATGATCTTGG + Intergenic
1188654329 X:32672415-32672437 GGATTTATATTATTAAATCATGG + Intronic
1189001737 X:36955223-36955245 GCATTTGCCTTGTTTGAACATGG - Intergenic
1190827323 X:54029497-54029519 GCTTTTCTATTTTTTGAACAGGG - Intronic
1191676423 X:63796354-63796376 TCATTAAAAGTGTTTGATCAGGG - Intergenic
1192316831 X:70059099-70059121 CCATTTTTATTGTTTGATGTTGG - Intergenic
1192622424 X:72692191-72692213 GAATATATATGGTTTGGTCAAGG + Intronic
1193754570 X:85392047-85392069 GCATTTGCCTTGTTTGAACAGGG - Intergenic
1195136575 X:101912679-101912701 GTGTGTATATTGTTTGATCAGGG + Intronic
1197014792 X:121610599-121610621 GCATTTATATTGTTTGCTCTAGG - Intergenic
1198535638 X:137583266-137583288 GCATATATAGTGTTCGATAAAGG + Intergenic
1198614965 X:138446982-138447004 GCATATATATGGTATGGTCAAGG - Intergenic
1199822342 X:151461953-151461975 GCATTTATGTTGTTTGGCCTTGG - Intergenic
1200881560 Y:8218041-8218063 GTATTTATTTTCATTGATCATGG + Intergenic
1201965599 Y:19730955-19730977 GTATATATACTGTTTGTTCATGG - Intronic