ID: 1017083677

View in Genome Browser
Species Human (GRCh38)
Location 6:150693543-150693565
Sequence CAGTGTGACCAAAGAGAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 1, 1: 0, 2: 8, 3: 31, 4: 267}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017083677_1017083682 -1 Left 1017083677 6:150693543-150693565 CCACCCTCTCTTTGGTCACACTG 0: 1
1: 0
2: 8
3: 31
4: 267
Right 1017083682 6:150693565-150693587 GGAGCACAGCTCCGTGGTTCAGG No data
1017083677_1017083681 -7 Left 1017083677 6:150693543-150693565 CCACCCTCTCTTTGGTCACACTG 0: 1
1: 0
2: 8
3: 31
4: 267
Right 1017083681 6:150693559-150693581 CACACTGGAGCACAGCTCCGTGG 0: 1
1: 0
2: 1
3: 18
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017083677 Original CRISPR CAGTGTGACCAAAGAGAGGG TGG (reversed) Intronic
902770069 1:18640789-18640811 CAGTGCGACCAGAGGGAGAGAGG + Intronic
903024165 1:20415422-20415444 CAGAGTGACCAAGGAGAGATGGG + Intergenic
903410711 1:23140974-23140996 CAGTGTGCCCAGGGAGAAGGTGG + Intronic
903502102 1:23806397-23806419 CAGTGTGACTGAGGAGAGGGGGG - Intronic
904275808 1:29383497-29383519 CAGTGAGACTGAAGAGATGGGGG - Intergenic
905227367 1:36488055-36488077 CAGTGAGAACAAAGACATGGAGG + Intergenic
905732126 1:40304510-40304532 CAGGGTGACCAAGGCGAGAGGGG - Exonic
905839551 1:41163021-41163043 CAGTTTGGGCAAAGAGAAGGAGG + Intronic
905908780 1:41639647-41639669 AAGGCTGACCACAGAGAGGGAGG - Intronic
907459384 1:54596274-54596296 CAGAGAGACCACAGACAGGGTGG - Intronic
909784062 1:79587378-79587400 CAGAGTTTCCAAAGAGAAGGGGG - Intergenic
913566301 1:120075932-120075954 CAGTGTGTGCAAAGAGACAGAGG + Intergenic
913631830 1:120717619-120717641 CAGTGTGTGCAAAGAGACAGAGG - Intergenic
914242893 1:145863992-145864014 CAGTGTAACCAAGCAGAGGGTGG + Intergenic
914286889 1:146235288-146235310 CAGTGTGTGCAAAGAGACAGAGG + Intergenic
914547921 1:148686031-148686053 CAGTGTGTGCAAAGAGACAGAGG + Intergenic
914618588 1:149384314-149384336 CAGTGTGTGCAAAGAGACAGAGG - Intergenic
915724307 1:158006972-158006994 CAGTGTAAGCAGAGAGAGGAGGG + Intronic
915824044 1:159056678-159056700 CAGTTTGCACAAGGAGAGGGAGG + Intergenic
915986709 1:160473296-160473318 CAGTGGGTCAAAAGAGTGGGAGG + Intergenic
916697598 1:167255384-167255406 CAATGTGAACAAAAAGAGAGAGG + Intronic
917276258 1:173334905-173334927 AAGTGTGACCCAAGAGGAGGTGG + Intergenic
919858041 1:201718996-201719018 CACAGAGACCAATGAGAGGGAGG - Intronic
920961082 1:210664687-210664709 CAGTGGATCCAAAGAGATGGTGG + Intronic
922551369 1:226496988-226497010 CTGTGGGAGCAAAGACAGGGTGG + Intergenic
923092035 1:230748044-230748066 CAGTGTTACCACACACAGGGTGG - Intronic
923261013 1:232268099-232268121 CAATGTGATCAAAGAAAGGAAGG - Intergenic
923690134 1:236184582-236184604 CAATGTGAGCAAAGAGCGGGTGG + Intronic
923706173 1:236346616-236346638 AAGTGTGTGCAAAGAGAGGTGGG - Intergenic
1065944399 10:30593699-30593721 CAGAGTGACCAAGGAGCAGGAGG - Intergenic
1066230149 10:33424259-33424281 CAGTCAGACCATAGAGAGGATGG - Intergenic
1066550710 10:36553263-36553285 CAGTGTGATCAGAGGCAGGGTGG + Intergenic
1070545238 10:77446872-77446894 CAGTGTGAACAAAGGTATGGAGG - Intronic
1070953235 10:80447394-80447416 CAGAGGGACCAAAGAGACTGAGG - Intergenic
1071073570 10:81725220-81725242 CAGTGTGTCCTATCAGAGGGTGG - Intergenic
1071735542 10:88294957-88294979 AAGTGTGACAAAAGAGAAGGTGG - Intronic
1072610989 10:97017627-97017649 CAGTGTGACTCATGAGATGGGGG + Intronic
1072637780 10:97188442-97188464 TAGGGAGACCCAAGAGAGGGAGG - Intronic
1073462479 10:103674010-103674032 CAGTATTCCCAAAGAGAGAGAGG - Intronic
1074318815 10:112382167-112382189 CAGTCCGACCTAAGTGAGGGCGG - Intronic
1075408744 10:122211875-122211897 CACTGTGACCGCAGAGAGGAAGG - Intronic
1075793292 10:125101301-125101323 AAGTGTGACCAAAGAGCCTGAGG - Intronic
1077633647 11:3827351-3827373 CAGTGTTCCCAAGCAGAGGGGGG + Exonic
1078628702 11:12982268-12982290 GAGAGTGACCCAAGAGAGAGAGG + Intergenic
1079007841 11:16804593-16804615 CTGTGTGACCAAAGGGATCGTGG - Intronic
1079617337 11:22511723-22511745 CTGTGTGACATAAGAGAAGGAGG + Intergenic
1081640628 11:44751007-44751029 TAGTGTGGCCAAAGAGAGAGAGG + Intronic
1082110017 11:48264163-48264185 CAGTGCCACCAAAGAAATGGAGG - Exonic
1082963510 11:58941723-58941745 CAGAGAGGCCAAAGAGAGTGAGG + Intronic
1084431835 11:69115633-69115655 AGGTGTGTCCAGAGAGAGGGAGG + Intergenic
1084943669 11:72627498-72627520 CAGTGTGAGCAAAGGCAGGGAGG + Intronic
1085470503 11:76754326-76754348 CAATGTGGCCCAAGAGAGGGAGG - Intergenic
1085710955 11:78828951-78828973 CAATGTGACCAATGAGAGGGTGG + Intronic
1085946359 11:81277904-81277926 CAGTTTGCACAGAGAGAGGGAGG - Intergenic
1088765277 11:112969462-112969484 GAGTCTGACCAAAGTGTGGGAGG + Intronic
1089814352 11:121159014-121159036 CACTGTGAGCACAGAGAGGCAGG + Intronic
1090344769 11:126061532-126061554 CAGTGTCTCCAAGGAGAGGAAGG - Intronic
1091205994 11:133821567-133821589 CAATGTGACCACGGAGGGGGTGG + Intergenic
1091243832 11:134074636-134074658 CAGTGTGTTCAAAAAGAAGGGGG - Intronic
1091283172 11:134393866-134393888 CAGTGCCCCCAAAGAGAGGGAGG + Intronic
1091461823 12:648864-648886 CAGTGTGAACAAAAAGCTGGAGG - Intronic
1092900146 12:13051606-13051628 CAGTCTGACCAGAGAAAGGGAGG - Intronic
1093254393 12:16848629-16848651 CATAGAGACCAAAGAGAGGTTGG + Intergenic
1098963881 12:76765373-76765395 CAAAGTGACGAATGAGAGGGTGG - Intronic
1099092747 12:78334034-78334056 TAGTGAGATCAAAGATAGGGCGG - Intergenic
1100490962 12:95077462-95077484 CTGTGTGAACAAAGAAAGGTTGG + Exonic
1102198025 12:111038020-111038042 CAGGATGAGCAAAGAGAGGCCGG + Intronic
1102411679 12:112725620-112725642 TAGTGTGACCAATCAGAGGTTGG + Intronic
1102900901 12:116635972-116635994 CAGTGTGAACAAAGTGAAGTTGG + Intergenic
1104002420 12:124868707-124868729 CAGAGTGGGCAAGGAGAGGGAGG - Intronic
1104187259 12:126444717-126444739 CACTGTCACCAAGGAGATGGTGG - Intergenic
1105631961 13:22178255-22178277 CCGTGAGACAAAAGAGAGTGAGG + Intergenic
1105672973 13:22641447-22641469 CACTGGAACCAAAGAGAGAGCGG - Intergenic
1106327932 13:28711991-28712013 CAGTGTGACCAAATAGAATTGGG - Intronic
1107012228 13:35680552-35680574 CAGGGTGGCCAAAGTCAGGGTGG + Intergenic
1107975335 13:45682765-45682787 CGATGTCAGCAAAGAGAGGGTGG + Intergenic
1109821044 13:67655076-67655098 CATTGTGAGCTAAGACAGGGAGG + Intergenic
1110257157 13:73444972-73444994 CAGTTTGCCCAGGGAGAGGGAGG - Intergenic
1110788961 13:79566482-79566504 CACAGTGGCCGAAGAGAGGGTGG + Intergenic
1110904834 13:80873738-80873760 CACTGACACCACAGAGAGGGTGG - Intergenic
1111830392 13:93322285-93322307 GAGGGTGAACAAAGAGAGAGAGG - Intronic
1113498612 13:110755048-110755070 CAGTGGCACAAAGGAGAGGGTGG + Intergenic
1113802314 13:113093017-113093039 CAGTGGGAACAAAAAAAGGGGGG - Intronic
1114212192 14:20624865-20624887 CAGTTTGAGCAAGGAGAGGTTGG - Intergenic
1118981247 14:70718734-70718756 CAGTGTGACCAATGACTGAGAGG + Intergenic
1119068485 14:71555780-71555802 TAGAGAGCCCAAAGAGAGGGAGG + Intronic
1120254552 14:82102666-82102688 TAATGAGACCAAGGAGAGGGTGG + Intergenic
1122139137 14:99651912-99651934 CACTGTTAACACAGAGAGGGTGG + Intronic
1123180690 14:106467398-106467420 CAGTGTGAGGAAGGAGATGGCGG + Intergenic
1202946209 14_KI270726v1_random:29260-29282 CAGTGTGAGGAAGGAGATGGCGG - Intergenic
1124416497 15:29476743-29476765 CAGAGGTACCAAAGTGAGGGCGG + Intronic
1124887794 15:33702951-33702973 CAGGGTGAGGAAAGAGAGAGAGG + Intronic
1127183232 15:56448394-56448416 CACTGTGAACTATGAGAGGGTGG - Intronic
1127920723 15:63492225-63492247 CACAGTGGCCAGAGAGAGGGAGG + Intergenic
1128554084 15:68618503-68618525 CAGTGTGATCAAAGGCTGGGAGG + Intronic
1129609853 15:77044536-77044558 CAGTGAGACCAAAAAGATGGAGG - Exonic
1130984982 15:88838820-88838842 CCGTGTGTCCAAGGAGAAGGAGG + Exonic
1131548060 15:93332613-93332635 CAGTGAGAGAAAAGAGATGGGGG + Intergenic
1131684879 15:94757759-94757781 AAGTGAAATCAAAGAGAGGGTGG - Intergenic
1131710566 15:95050745-95050767 CAGTGTGTCCTACTAGAGGGTGG - Intergenic
1133396814 16:5454008-5454030 AAGGGTGACTAAAGAGAGGGAGG + Intergenic
1134650509 16:15904784-15904806 CAGAGTGACCAAAGAGCAGGTGG - Intergenic
1136096744 16:27962431-27962453 CAGTGGGACAACAGAGAGAGTGG + Intronic
1136286606 16:29247866-29247888 CAGTGTGACCCATGACAGGAAGG + Intergenic
1137273522 16:46918544-46918566 CAGTGTGGCCAAGGCAAGGGAGG - Intronic
1138172692 16:54867637-54867659 CATTGTCACTAAAGAGAGGCAGG - Intergenic
1141883730 16:86877717-86877739 CAGAGAGACCAGAGAGAGAGAGG - Intergenic
1142277874 16:89132482-89132504 TATTGTGACCATGGAGAGGGCGG - Intronic
1142946411 17:3433065-3433087 CAGTGACACCACAGAGAGGTGGG + Exonic
1144876424 17:18399655-18399677 CAGTGTGTCCACTGAGAGTGTGG + Intergenic
1145155802 17:20544765-20544787 CAGTGTGTCCACTGAGAGTGTGG - Intergenic
1146605689 17:34255712-34255734 CAGGGTAATCAAAGAGAGGGTGG + Intronic
1147054799 17:37825893-37825915 CACGGGGACCAAAGAGAAGGAGG - Intergenic
1147250441 17:39150138-39150160 CAGGGAGACCACACAGAGGGTGG - Intronic
1151360505 17:73585734-73585756 CTGTGTGAGCCAACAGAGGGTGG + Intronic
1153215007 18:2811300-2811322 CACTGTGTCCAAAGAGAGACAGG - Intergenic
1154370628 18:13758929-13758951 CAGAGAGGCCAAGGAGAGGGAGG + Intronic
1155044084 18:22088583-22088605 CAGTGAGACAACAGAGAGGTTGG + Intronic
1155397409 18:25401118-25401140 CATAGTGACAAAGGAGAGGGAGG + Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1157554856 18:48606718-48606740 TACTCTGACCAAAGAGAGTGAGG - Intronic
1159784491 18:72697157-72697179 CAGTTTGCACAGAGAGAGGGAGG - Intergenic
1161346553 19:3771305-3771327 CAGTGTGTGCAAAGACATGGAGG - Intronic
1162743138 19:12784202-12784224 CAGGGTGACCAGACAGGGGGCGG + Intronic
1163567192 19:18058707-18058729 CAGTGTGGGCAGAAAGAGGGAGG + Intergenic
1164771732 19:30815030-30815052 CAGTGTGACTAGAGAGGAGGAGG + Intergenic
1166388894 19:42397831-42397853 CAGCGTGACCAAAGACAGGGAGG + Intergenic
1166782471 19:45349676-45349698 CAGGGTGAGCAACGTGAGGGTGG + Intronic
926630448 2:15130794-15130816 CAGTGTGGGAAGAGAGAGGGTGG - Intergenic
929087711 2:38184605-38184627 CAGTGTGCCCAGAGAGAGAGTGG + Intergenic
929474932 2:42236798-42236820 CAGTGTTCCCAAAGATATGGAGG - Intronic
930319089 2:49831811-49831833 AAATTTGACCAAAGAGAGAGAGG - Intergenic
931292270 2:60883098-60883120 CAGCGTGAGCAAAGGCAGGGAGG + Intronic
931673376 2:64669544-64669566 CAGGATGAACAAAGATAGGGAGG + Intronic
931864964 2:66399600-66399622 CACTGTGACCATAGAAAGGCAGG + Intergenic
931893211 2:66698698-66698720 CAGTCTGACCAAAGAGAAGAAGG - Intergenic
933759391 2:85663572-85663594 CAGTGGGACCACAGAGGGAGAGG + Intronic
934077333 2:88439310-88439332 CAGTGGGAGCAAAGAGGGGCTGG - Intergenic
935180900 2:100690553-100690575 CAGTCTGATGAAAGAGAAGGAGG - Intergenic
935552556 2:104473800-104473822 CTTTGTGACCAATGAGAGAGTGG + Intergenic
937318302 2:120946002-120946024 CAGTGTGTGCAAAGAAAGGCTGG - Intronic
938017626 2:127880610-127880632 CAGCGTCCCCACAGAGAGGGAGG - Intronic
939117172 2:138073589-138073611 CAGGGACACCAAAGAGAGGGAGG - Intergenic
939208679 2:139142607-139142629 GAGTGTGTTCCAAGAGAGGGTGG - Intergenic
940786729 2:157989425-157989447 CAGGGAGCCCACAGAGAGGGGGG - Intronic
940991063 2:160097326-160097348 CAATGACACCAAAGAGTGGGGGG + Intergenic
941214663 2:162690964-162690986 CAGTGTTAATAAAGATAGGGAGG + Intronic
942429906 2:175899506-175899528 CAGTGAGGCCAAAGAGAGATGGG - Intergenic
942610629 2:177738693-177738715 CAGCCTCACCAGAGAGAGGGAGG + Intronic
943432139 2:187817169-187817191 CAGTGTGACAAATGAAGGGGTGG + Intergenic
945220495 2:207478683-207478705 CAGTCTGTCGTAAGAGAGGGAGG - Intergenic
945395953 2:209317800-209317822 CCCTGTGACCACAGGGAGGGAGG - Intergenic
946297197 2:218794541-218794563 CAGTTTGCCCAGGGAGAGGGAGG + Intronic
946732626 2:222723942-222723964 AAGTGTGAGCCCAGAGAGGGCGG - Intergenic
946777150 2:223155291-223155313 CAGGGAAACCATAGAGAGGGGGG - Intronic
946884363 2:224208348-224208370 CAGTGTGAGCAAGGAGAGGTTGG + Intergenic
948126089 2:235565487-235565509 CAGTGTGACCTACGAAAGGTGGG + Intronic
948189978 2:236051074-236051096 CAGTGTGACTAAAGAAAAGATGG - Intronic
948352322 2:237351048-237351070 CAGACTGACCAAAGAGGGAGAGG + Intronic
948795249 2:240399238-240399260 CAGTGTGGGCAGAGAGAGGTGGG - Intergenic
948991164 2:241554797-241554819 TTGTGTGACCAGAGAGAGGTCGG - Intergenic
1170211053 20:13846623-13846645 CTGTGTGCCCATAGAGTGGGTGG + Intergenic
1172956466 20:38763150-38763172 CAGTGTGACATAACAGAAGGTGG - Intronic
1173217697 20:41101520-41101542 CAATGTGACCAAAAAAATGGAGG - Intronic
1173374037 20:42467054-42467076 CAGGGAGACCAAAAACAGGGAGG + Intronic
1173530651 20:43766869-43766891 CAGTATGAACAAAGACAGGGAGG - Intergenic
1173546647 20:43903064-43903086 CAGTAAGAGCAAAGACAGGGTGG - Intergenic
1173665041 20:44757261-44757283 CAGAGTGAGCAAAGGAAGGGTGG - Intronic
1175119074 20:56704532-56704554 GAGTGTTACAAAAGAGAGGGTGG + Intergenic
1175482536 20:59321650-59321672 GAGGGTGGCCAAAGAGAAGGGGG - Intronic
1176374308 21:6079633-6079655 CAGTGTGGCCTAAGCAAGGGAGG + Intergenic
1177843604 21:26262615-26262637 CAGTGTGTACTAAGAGATGGAGG - Intergenic
1179749168 21:43458612-43458634 CAGTGTGGCCTAAGCAAGGGAGG - Intergenic
1180712089 22:17846279-17846301 CAGTGTTTCCAAAGGGAAGGTGG + Intronic
1181928947 22:26383805-26383827 CAGGCTGAGCTAAGAGAGGGAGG - Intergenic
1183352608 22:37342558-37342580 CAGTGGGACCCAGGAGTGGGGGG - Intergenic
1184906669 22:47492171-47492193 CAGAGAGACAAAAGACAGGGAGG - Intergenic
1185248208 22:49784759-49784781 CGGTGAAACCAAAGCGAGGGCGG + Intronic
1185416365 22:50712521-50712543 CAGTGGGTCGAGAGAGAGGGAGG - Intergenic
950238664 3:11347588-11347610 CAGTGTCACCAAAGATTTGGAGG - Intronic
951182213 3:19671852-19671874 CATTGAGAGCAAAGAGAAGGAGG - Intergenic
952389209 3:32865427-32865449 CAGTGTGGCCTGAGAAAGGGTGG - Intronic
953727529 3:45413260-45413282 AAATGTGGCCAAAGAGATGGAGG + Intronic
953862701 3:46558625-46558647 CAGGGAGATCACAGAGAGGGAGG - Intronic
954789845 3:53124170-53124192 CAGTGTGACCAAGAAGGGTGGGG - Intronic
957169916 3:76724901-76724923 CAGTGTGACCACAGAGGCAGAGG + Intronic
958693607 3:97500187-97500209 CAGTGTGACAAAAGATGTGGAGG - Intronic
961514554 3:127424603-127424625 GTGTGTGAACAGAGAGAGGGAGG - Intergenic
961760436 3:129163264-129163286 CAGTGTGAGCAGAGAAAGGAAGG - Intergenic
962925795 3:139992345-139992367 CAGGGTTATCAAAGAGAAGGAGG - Intronic
962982827 3:140506385-140506407 GAGTGTGACGAAAGAGAGGCAGG - Intronic
963361117 3:144273034-144273056 CAGTGTTTCCATAAAGAGGGCGG - Intergenic
964940787 3:162156557-162156579 AAGTGAGAGCAAAGAGAGGCTGG + Intergenic
966044802 3:175534877-175534899 CAGTGTGAACAAAGAAAGAAAGG - Intronic
967240687 3:187436413-187436435 CAGAGTGAAAAAAGAGAAGGAGG - Intergenic
967586197 3:191216962-191216984 AATTGTTACCAAAGAGAGTGGGG - Intronic
970444832 4:16114969-16114991 CAGTATGACCAAAGTAGGGGGGG + Intergenic
970813280 4:20122486-20122508 CTGTGTCAACACAGAGAGGGTGG - Intergenic
972342646 4:38165850-38165872 CAGTGTGCCCAAAGAGATGCTGG - Intergenic
973728150 4:53796422-53796444 CAATGTGACCACAGAGACAGAGG + Intronic
974136798 4:57828185-57828207 CAGTGAAATCAAAGAGAGAGGGG + Intergenic
974330805 4:60475783-60475805 TAGGGTGACCATTGAGAGGGAGG + Intergenic
974675161 4:65079388-65079410 CAGTTTGAACATGGAGAGGGAGG - Intergenic
976858349 4:89630806-89630828 CAGAGTGAAGAAACAGAGGGAGG - Intergenic
978193180 4:105939649-105939671 CAGTCTAACCCAAGAGATGGTGG + Intronic
978459972 4:108940627-108940649 CAGGGTGACCAAGGACAGGCAGG - Exonic
979406840 4:120322996-120323018 CTGAGTGAGCAAAGAGAGTGTGG - Intergenic
981195904 4:141920110-141920132 CAGTGGGACCACAGGGAGTGGGG - Intergenic
982406626 4:155027513-155027535 CAGAGTGGCCAAAGAGAGGGTGG - Intergenic
985954470 5:3253196-3253218 GATTGTGACAAAACAGAGGGTGG - Intergenic
986014227 5:3743713-3743735 CACTGTCACCATAAAGAGGGGGG + Intergenic
988233574 5:28509450-28509472 GAGTGTGACCCATGAGAAGGTGG - Intergenic
989540413 5:42611436-42611458 CAGTATGAACAAAGAGATAGTGG - Intronic
989715172 5:44454410-44454432 CAGTTTTAACAGAGAGAGGGAGG + Intergenic
990408484 5:55516226-55516248 CAGTGAGACTAAAGAGGTGGTGG - Intronic
990757381 5:59088771-59088793 CACTGTGACCTATCAGAGGGTGG + Intronic
991361033 5:65820537-65820559 CATTTTGACCAAAGAAAGGAAGG + Intronic
993096947 5:83490365-83490387 CAGCTTGACCACAGTGAGGGAGG - Exonic
994247368 5:97494767-97494789 AAGTGTGACCAAGGAGTGGTAGG + Intergenic
995511890 5:112918772-112918794 CTGTGTGAGCAAAGAGTGGTGGG - Intronic
995730938 5:115240956-115240978 CAGTGAGTCCTAACAGAGGGAGG - Intronic
996268567 5:121574244-121574266 CAATTTGTTCAAAGAGAGGGTGG + Intergenic
996324693 5:122259165-122259187 CAGTGTGTCCCAAGAGTGAGGGG + Intergenic
997346070 5:133193068-133193090 CAGTGAGAGCCAAGAGTGGGCGG + Intergenic
997353822 5:133249517-133249539 CAGTGTGACCACAGTGACCGTGG - Exonic
999121737 5:149215024-149215046 CAGTTTGAGCAAAGGGAGGTAGG - Intronic
1001453885 5:171846327-171846349 CAGTGCTACCTAGGAGAGGGAGG + Intergenic
1001572908 5:172742231-172742253 CAGTGTTACCAGAGTGAGTGGGG - Intergenic
1001976850 5:176007178-176007200 CAGGGTGACCAGAGACAGGTGGG - Intronic
1002240578 5:177836602-177836624 CAGGGTGACCAGAGACAGGTGGG + Intergenic
1003799820 6:9651132-9651154 GAATGTGACGAAAGAGAGGGAGG - Intronic
1003863023 6:10339097-10339119 CAGTGTCATCAAAGAGAGGGAGG - Intergenic
1004472848 6:15944428-15944450 GAGTGAGACCAAAGAAAGGAAGG + Intergenic
1005532620 6:26722738-26722760 CAGGGTGACTAAAGAGAGGGTGG - Intergenic
1005535784 6:26754865-26754887 CAGGGTGACTAAAGAGAGGGTGG + Intergenic
1005538175 6:26778927-26778949 CAGGGTGACTAAAGAGAGGGTGG + Intergenic
1005602703 6:27443885-27443907 GAGTGTGACCCAAGAGAGAGGGG - Intergenic
1006144053 6:31947674-31947696 TACAGTGACCAAAGAGACGGGGG - Intronic
1006934882 6:37710382-37710404 CTGGGTGAGCACAGAGAGGGAGG - Intergenic
1007282068 6:40720222-40720244 CAGTGTGATCACAGAGAGAGAGG + Intergenic
1007933269 6:45711226-45711248 CAGTGTGATCTATGAAAGGGTGG + Intergenic
1008628220 6:53338304-53338326 CAGTGTGACCCAAGGGAAGTTGG - Intronic
1011787337 6:90861820-90861842 CAGTGTGAGCAAAGATGGAGTGG - Intergenic
1015190603 6:130467816-130467838 CAGAGTGAGCAGAGGGAGGGAGG - Intergenic
1017083677 6:150693543-150693565 CAGTGTGACCAAAGAGAGGGTGG - Intronic
1018036876 6:159889314-159889336 CAGAGTGACCAACTAGAAGGAGG - Intergenic
1018351285 6:162961906-162961928 GAGTGTGAGCAAAGACAGAGAGG - Intronic
1018429754 6:163713557-163713579 CAGCCTCACCAAAGAGATGGGGG - Intergenic
1018982777 6:168613350-168613372 CAGTGTGAGGACAGAGGGGGCGG + Intronic
1019420343 7:947904-947926 CAGTGTGCCCAGAGCCAGGGCGG - Intronic
1019479416 7:1259749-1259771 GAGTGTGAGCAGAGGGAGGGTGG + Intergenic
1019982252 7:4630177-4630199 CAGTGTGGACAAAGAGACTGAGG - Intergenic
1021202831 7:17744392-17744414 CAGTGTGAGAACAGACAGGGGGG + Intergenic
1021848010 7:24781172-24781194 CAGTGTGACCACAGACAGGCAGG + Intergenic
1021890380 7:25180668-25180690 CAGTGTGGCCAGATAGAGGGTGG + Intergenic
1022447579 7:30482517-30482539 AAGTGAGAGCAAAGAGAGGCTGG - Intergenic
1030844591 7:114393467-114393489 GAGTCTGACCAGAGAGAGGAGGG + Intronic
1031121789 7:117730266-117730288 CAATGTGACCACAGATAGAGAGG + Intronic
1032194380 7:129780850-129780872 CTGTCTGTCCCAAGAGAGGGAGG + Intergenic
1033631900 7:143166495-143166517 CAGTGTGACCAAAGAAAGGAAGG - Intergenic
1036296300 8:7540926-7540948 CAGAGAGACCACAGTGAGGGAGG - Intronic
1036326266 8:7780093-7780115 CAGAGAGACCACAGTGAGGGAGG + Intronic
1039450680 8:37672542-37672564 CAGGGTGTCCATAGAGAGAGGGG + Intergenic
1041104059 8:54424584-54424606 CAGGGAGACCTAAGAGATGGCGG - Intergenic
1041116806 8:54547945-54547967 CAGTGTGGCCTATCAGAGGGTGG + Intergenic
1043185067 8:77138103-77138125 CAGGGTGACAAAAAAGAAGGAGG - Intergenic
1043400481 8:79879583-79879605 CAGGGTGAGCATAGAGAGGTGGG + Intergenic
1043436807 8:80243065-80243087 CAGTGTGACCCAAGACAGCCAGG - Intergenic
1045278113 8:100724753-100724775 GTGTGTGACAAAAGAGAGGGAGG - Intergenic
1045378639 8:101600786-101600808 CAGTGTGACCAGGGAGAGGCAGG + Intronic
1046090438 8:109497386-109497408 CAGTGGGAACAAAGGCAGGGAGG - Intronic
1049128100 8:140810555-140810577 CAGTGTGAGGAAGGAGCGGGTGG - Intronic
1049411705 8:142476515-142476537 CACTGTGGCCACAGAGAGAGAGG + Intronic
1050752449 9:8956148-8956170 CAGTGTGAACAAAGAGTGTGGGG + Intronic
1052694003 9:31853604-31853626 CATTGAGAACAAACAGAGGGAGG + Intergenic
1053885691 9:42643920-42643942 AAGTGTGGCCAAAGGGAGTGGGG - Intergenic
1054224709 9:62451369-62451391 AAGTGTGGCCAAAGGGAGTGGGG - Intergenic
1058112552 9:101046933-101046955 CAATGTGACCAAAGAAGGGGGGG - Intronic
1058991481 9:110257935-110257957 CAATGTTCCCAAAGAGAGGGAGG + Intergenic
1059399829 9:114061955-114061977 CAGTGGGAGCAAAGGCAGGGTGG - Intronic
1059682844 9:116603403-116603425 CAGTGTGGCCCAGGAGTGGGTGG + Intronic
1059751675 9:117253515-117253537 CATTGTGACAAAAGCAAGGGAGG + Intronic
1060991270 9:127850524-127850546 CCGTGTGAACCAGGAGAGGGTGG - Intronic
1062562447 9:137147712-137147734 GAGGGAGACCAAGGAGAGGGAGG + Intronic
1062728672 9:138096211-138096233 CAATGTGATCACAGAGAGGAAGG + Intronic
1187736619 X:22311404-22311426 TAGTGTGCCCACAGTGAGGGGGG + Intergenic
1187953861 X:24496701-24496723 CACTGTGACCAAGGGGATGGTGG - Intronic
1189552493 X:42107634-42107656 CAGTTTTACTAAAGAGTGGGAGG + Intergenic
1191936741 X:66435131-66435153 CAGAGAGACCAAAGAGAGCAAGG + Intergenic
1192449575 X:71235513-71235535 CAGTGTGAACAAAGGCATGGAGG - Intergenic
1192509314 X:71712589-71712611 CAGGATGCCCACAGAGAGGGTGG - Intergenic
1192517383 X:71768964-71768986 CAGGATGCCCACAGAGAGGGTGG + Intergenic
1194887525 X:99335216-99335238 CATTGTGACCTAATTGAGGGTGG - Intergenic
1196025025 X:111033115-111033137 CTGTGTGTACAGAGAGAGGGAGG - Intronic
1196919544 X:120571627-120571649 CAGTGTGTGCAAAGACATGGAGG + Intronic
1197436858 X:126439850-126439872 CAGTGAAGCCAAACAGAGGGAGG - Intergenic
1198427297 X:136532919-136532941 CAGTGAGGCTAAAGAAAGGGTGG - Intronic
1198447130 X:136728353-136728375 CAGTGTGACCAAAGTGGCTGTGG - Intronic
1198662237 X:138982149-138982171 AGGTGTGACCAGAGAGAGGTTGG + Intronic
1199188406 X:144942022-144942044 CAGTGAGAAGAAAGAAAGGGAGG - Intergenic
1200060051 X:153480152-153480174 CAGTGTGTCCCAAGGGTGGGGGG - Intronic
1201857318 Y:18559103-18559125 AAGAGTCACCAAAGTGAGGGTGG - Intronic
1201876003 Y:18761277-18761299 AAGAGTCACCAAAGTGAGGGTGG + Intronic
1202162292 Y:21948037-21948059 AAGTGTGGCCAAAGAGAAGCAGG + Intergenic
1202229064 Y:22638336-22638358 AAGTGTGGCCAAAGAGAAGCAGG - Intergenic
1202314090 Y:23557829-23557851 AAGTGTGGCCAAAGAGAAGCAGG + Intergenic
1202556712 Y:26112766-26112788 AAGTGTGGCCAAAGAGAAGCAGG - Intergenic