ID: 1017091954

View in Genome Browser
Species Human (GRCh38)
Location 6:150767129-150767151
Sequence TCTTTATTTTGAGGGAGTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 490
Summary {0: 1, 1: 0, 2: 2, 3: 59, 4: 428}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017091949_1017091954 27 Left 1017091949 6:150767079-150767101 CCATCCTTTTGGACCATGTGTAA 0: 1
1: 0
2: 0
3: 18
4: 173
Right 1017091954 6:150767129-150767151 TCTTTATTTTGAGGGAGTGTAGG 0: 1
1: 0
2: 2
3: 59
4: 428
1017091951_1017091954 14 Left 1017091951 6:150767092-150767114 CCATGTGTAATTTAACAGAAATA 0: 1
1: 0
2: 3
3: 40
4: 408
Right 1017091954 6:150767129-150767151 TCTTTATTTTGAGGGAGTGTAGG 0: 1
1: 0
2: 2
3: 59
4: 428
1017091950_1017091954 23 Left 1017091950 6:150767083-150767105 CCTTTTGGACCATGTGTAATTTA 0: 1
1: 1
2: 0
3: 21
4: 192
Right 1017091954 6:150767129-150767151 TCTTTATTTTGAGGGAGTGTAGG 0: 1
1: 0
2: 2
3: 59
4: 428

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017091954 Original CRISPR TCTTTATTTTGAGGGAGTGT AGG Intronic
901406517 1:9050918-9050940 TATGTATTTTGAGGCTGTGTTGG - Intronic
902492937 1:16798535-16798557 TTTTTTTTTTGATGGAGTTTTGG + Intronic
902541148 1:17155860-17155882 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
903567661 1:24280733-24280755 TCTTTATTTTGAGAGGGTTTGGG - Intergenic
904211780 1:28890732-28890754 TCTTTGTTTTGCAGGAGTTTAGG + Intronic
904879946 1:33688811-33688833 TCTTTTTTTTGGAGGAGGGTTGG - Intronic
905830652 1:41064188-41064210 TTTTTATTATGAATGAGTGTTGG - Intronic
906224400 1:44109310-44109332 TCTTTGTTTTCTGGGAGTTTGGG - Intergenic
907698866 1:56763454-56763476 TATTTATTTTGAGTGAGTTGTGG + Intronic
908803954 1:67910254-67910276 TCTTTATTGTGAGGTGGTGAGGG + Intergenic
909703852 1:78557221-78557243 TTTTTATCATGAAGGAGTGTTGG - Intergenic
909704887 1:78569584-78569606 TCTATGTTTTGAGGCATTGTAGG + Intergenic
910269276 1:85375924-85375946 TTTTTATTTTTAAGGAATGTTGG - Intronic
911068949 1:93816966-93816988 TTTTTTTTTTGAGGGGGTGGTGG - Intronic
912046961 1:105470882-105470904 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
914927950 1:151905650-151905672 TCCTTTTGTTGAGGGAGTGCTGG - Intronic
915455087 1:156035290-156035312 TCTTTGTTGTGAGAGTGTGTTGG - Exonic
915732809 1:158066212-158066234 TCTTTATTTTGAAGGAGCTGAGG - Intronic
915752738 1:158227358-158227380 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
916160718 1:161910119-161910141 CATTTATTTTGAGGAAGTGGAGG + Intronic
917173991 1:172210959-172210981 TTTTTGTTTTGAGGGAGGGAAGG - Intronic
917858208 1:179119537-179119559 TCTTTTTTTTGGGGGGGTGTGGG - Intronic
918848232 1:189646918-189646940 TTTTTTTTTTGAGGCAGAGTCGG + Intergenic
919686667 1:200489301-200489323 TCTTTTTTTTGTGGGGGGGTGGG + Intergenic
920879047 1:209863352-209863374 GCTTTGTTTTGATGGAGTGTAGG - Intergenic
921234053 1:213106505-213106527 TCCTTAATTTGAAGGAGTCTCGG + Intronic
921686928 1:218100416-218100438 TCTGGATTTTGAGGGTGTTTTGG - Intergenic
921968500 1:221119024-221119046 TTTTTATTTTGAGGGTGAGAAGG - Intergenic
923527510 1:234783993-234784015 TTTTTTTTTTGATGGAGTTTTGG - Intergenic
923949678 1:238934750-238934772 TTTTTATATTGAAGTAGTGTTGG - Intergenic
924108733 1:240676168-240676190 CCTATATTTTGAGGGAAGGTGGG - Intergenic
924524135 1:244831812-244831834 TTTTTAATTTGGGGGAGGGTGGG - Intergenic
924802242 1:247335858-247335880 TCCTTATTTTACTGGAGTGTTGG - Intergenic
1064095607 10:12422354-12422376 TCTTGATTTTCAGCGTGTGTTGG + Intronic
1064759699 10:18605183-18605205 TTTTTTTTTTAAGGGAGTCTCGG - Intronic
1065188335 10:23190201-23190223 TCTTTTTTTGGGGGGAGGGTGGG - Intergenic
1065586722 10:27225793-27225815 TCTTTATATTACGGCAGTGTGGG - Intronic
1065620311 10:27574404-27574426 TCTTTCTTTTGAGGGCATTTTGG - Intergenic
1066347173 10:34599101-34599123 TGTTTTGTTTGGGGGAGTGTGGG - Intronic
1066595742 10:37048144-37048166 TTATTATTGTGTGGGAGTGTAGG + Intergenic
1067772439 10:49136970-49136992 TCTTTATTTTGATGGATCTTAGG - Intergenic
1069595967 10:69670428-69670450 TCTATATTTTGAGTGAATGGTGG + Intergenic
1070081533 10:73193463-73193485 TCTTCATTTTGAAGGATTCTAGG + Exonic
1070503908 10:77096455-77096477 TGGCTTTTTTGAGGGAGTGTGGG - Intronic
1071224220 10:83509214-83509236 TTTTTATTTTGGGGAAGTGCCGG + Intergenic
1071700045 10:87921685-87921707 TCTTTAACTTGAGGCAATGTAGG + Intronic
1072040600 10:91602575-91602597 GATTTATTTTAAGGGACTGTAGG - Intergenic
1073390776 10:103174572-103174594 TTCTTTTTTTGAGGGAGTGCTGG - Intronic
1074225950 10:111484398-111484420 TCTTTTTTTTTAGGGGGGGTGGG + Intergenic
1074706644 10:116138766-116138788 GTTTTATTTTAATGGAGTGTTGG + Intronic
1074706950 10:116141575-116141597 TCTTTTTTTTGAGGGGGTGGTGG + Intronic
1075642603 10:124075619-124075641 TTTTTATTGGAAGGGAGTGTAGG - Intronic
1076170452 10:128314983-128315005 TATTGATTTTGGGGGAGTCTGGG - Intergenic
1077620479 11:3717780-3717802 CCTTTATTATGAAAGAGTGTTGG + Intronic
1077660145 11:4060531-4060553 CCTTTTTTTTGGGGGAGTGGAGG + Intronic
1079255237 11:18822214-18822236 TTTTTTTTTTGATGGAGTCTCGG + Intergenic
1080290923 11:30670461-30670483 TATTTATTTTGAAGAATTGTGGG + Intergenic
1081037981 11:38174082-38174104 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1081814180 11:45929395-45929417 TTTTTGTTTTGAGGGGGTGGGGG - Intronic
1081839723 11:46189981-46190003 TCTTGATTATGAATGAGTGTTGG - Intergenic
1081879292 11:46434383-46434405 TGTTTGTTTTGCGGGAGGGTGGG - Intronic
1082727624 11:56755458-56755480 TCTTTGTTTTTAGGTAATGTTGG - Intergenic
1083788750 11:64970663-64970685 TCTTTTTTTTAAGACAGTGTGGG - Intronic
1084011414 11:66351413-66351435 TTTTTATCTTGAACGAGTGTTGG + Intronic
1084011415 11:66351450-66351472 TTTTTATCTTGAACGAGTGTTGG + Intronic
1084998610 11:73008324-73008346 TCTTTGTTTTGAGACAGTCTCGG - Intronic
1086571191 11:88286288-88286310 TCTTTATTTTGATGAAATGTTGG + Intergenic
1087440798 11:98181027-98181049 TTTTTATTTTGAGAGAGTCTGGG + Intergenic
1088076254 11:105852213-105852235 TTTTCGTTTGGAGGGAGTGTGGG + Intronic
1088436680 11:109821109-109821131 TCATTATTTTGAGGAAATCTTGG - Intergenic
1089032591 11:115347999-115348021 CATATATTTTGAGGGAGTGCAGG + Intronic
1089206837 11:116771174-116771196 TCTTAGTCTTGAGTGAGTGTGGG - Intronic
1089551132 11:119279181-119279203 TTTTTATTTTAATGGAGTCTTGG + Intronic
1091040339 11:132273101-132273123 TTTTTATCATGAAGGAGTGTTGG + Intronic
1092115428 12:5998453-5998475 TTTTTTTTTTGACGGAGTCTCGG - Intronic
1092705444 12:11279117-11279139 ACTTGATTTTGTCGGAGTGTGGG - Intergenic
1093341013 12:17973982-17974004 TCTTATTTTTGGGGGAGTATAGG - Intergenic
1094564186 12:31584833-31584855 TCTTTTTTTTCGGGGAGGGTGGG - Intronic
1095381859 12:41604688-41604710 TCTTTTTTTTGGGGGGGTGGGGG + Intergenic
1095855647 12:46857892-46857914 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1097138298 12:56878361-56878383 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1097233130 12:57523943-57523965 TCTTTCTTTTGAGAGGGTGCTGG + Intronic
1097859334 12:64502980-64503002 TGTTTAGTTTGAGAGTGTGTGGG + Intergenic
1097884669 12:64717093-64717115 TTTTTCTTTTGAGGGAGTAGGGG + Intronic
1099035342 12:77580196-77580218 TCTTTATTTGGGGGTAGGGTGGG + Intergenic
1099552078 12:84058449-84058471 CCTTTAGTTTGAGGTAGTTTTGG + Intergenic
1099775826 12:87128149-87128171 TCTTTTTTTTGCGGGGGTGGGGG + Intergenic
1099926621 12:89026712-89026734 TCTTTTTTTTGGGGGGGGGTTGG + Intergenic
1100515337 12:95322199-95322221 TTTTTTTTTTGAGGGAGCATTGG + Intergenic
1101046931 12:100817076-100817098 TCATTATTTTGTAGGAATGTGGG + Intronic
1102645648 12:114401979-114402001 TCTGTGTTTTGGGGGAGTTTGGG - Intronic
1103816820 12:123664885-123664907 TCTTTTTTGTGACGGAGTCTTGG + Intergenic
1105468573 13:20670633-20670655 TCTTTAGTTTAAGGGAGGGATGG - Intronic
1105810390 13:23990308-23990330 GCTTTATTCTGGGGGAGTGGTGG - Intronic
1107274152 13:38657762-38657784 TCTTTTTTTTGGGGGAGAGGGGG + Intergenic
1107538236 13:41357570-41357592 TGTTTGTTTTGATGTAGTGTGGG + Intronic
1107768326 13:43761634-43761656 TCTTCAACTTGAGGGACTGTAGG + Intronic
1107833621 13:44396421-44396443 TTTTTTTTTTGAAGGAGGGTGGG - Intronic
1107914285 13:45133463-45133485 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1108337790 13:49463826-49463848 TCTCTATGTTGAGGGAGTGCTGG + Intronic
1108720799 13:53129752-53129774 TCTTTGTTTTTAGGGGGTTTTGG + Intergenic
1109487402 13:63045043-63045065 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1111162114 13:84408256-84408278 TCTCTATTTCTAGGGAGTCTCGG + Intergenic
1111406685 13:87815847-87815869 TATTTATTTTGTGTGAGTTTTGG - Intergenic
1111726614 13:92017878-92017900 TGTGTATTTTGTGGAAGTGTAGG - Intronic
1111862945 13:93731064-93731086 GCTTTGTCATGAGGGAGTGTGGG + Intronic
1113047490 13:106171410-106171432 GCTTTATTTTGAGGATGAGTGGG - Intergenic
1113734412 13:112667815-112667837 GCTTTATTCTGAAGGGGTGTTGG - Intronic
1114253267 14:20979921-20979943 TTTTAATTTTGAGGCAGTGGAGG + Intergenic
1115227184 14:31115931-31115953 TCTTGATTTTGGGGGTGTGTGGG - Intronic
1115593195 14:34884175-34884197 TCTTTTTTTTGAGTTAGTGATGG - Intergenic
1115616727 14:35102505-35102527 TTTTTATTTTGAGTAACTGTTGG - Intronic
1115632613 14:35260406-35260428 TCCTTATGTTGAGGGAGTACTGG - Intronic
1116395984 14:44449209-44449231 TCCTTATGTTGAGGGAGTGTTGG + Intergenic
1116897880 14:50334921-50334943 TTTTTTTTTTGAGGGGGTGGGGG + Intronic
1116993195 14:51297077-51297099 TGTTTATTTTGAGGAAGAGCAGG - Intergenic
1117015460 14:51513023-51513045 TCCTAATTTTGAGAGAGTGAGGG - Intronic
1117704147 14:58445792-58445814 TTTTTTTTTTGAGTGAGTGAGGG + Intronic
1120154837 14:81082107-81082129 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1121801622 14:96778903-96778925 TCTTTATATTGAGGAAATGGAGG + Intergenic
1122647539 14:103205378-103205400 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1122687430 14:103516295-103516317 TCTTTTTTTAGACGGAGTTTTGG - Intergenic
1123213785 14:106786792-106786814 TTTTTATTATGAGTGAGTGTTGG + Intergenic
1123218635 14:106836579-106836601 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1123220007 14:106845812-106845834 TCCTTATGCTGAGGGAGTGCTGG + Intergenic
1125014640 15:34920369-34920391 TCTTCATTTTTAGGAAGAGTTGG + Exonic
1126519633 15:49577296-49577318 TCTTTTTTTGCAGGGGGTGTGGG - Intronic
1126521787 15:49603851-49603873 TTTTTATCTTGAAGGAATGTTGG + Intronic
1127627332 15:60793011-60793033 TCTCTCTTTTGAGGGAGTGGTGG - Intronic
1127652010 15:61018469-61018491 TCTAAATTGTGAGGGCGTGTGGG + Intronic
1127966929 15:63929569-63929591 TCTTTATTTTGCAGGAGCATAGG - Exonic
1128600568 15:68992161-68992183 TCCTTATGTTGAGGGAGTGCTGG + Intronic
1128887656 15:71303290-71303312 TCTTTATTCTGAGTGTATGTGGG - Intronic
1130370195 15:83279386-83279408 TATTTAATTTGGGGGAGAGTAGG - Intronic
1131202447 15:90410871-90410893 TCTTTTTTTTGAGGGGATCTTGG - Intronic
1132054990 15:98644397-98644419 TCTATATCTTGATGGGGTGTTGG - Intergenic
1132383468 15:101382884-101382906 TCTTTGTTTTGCAGGAATGTCGG - Intronic
1133676221 16:8075446-8075468 TCTTTATGAAGAGGGAATGTAGG - Intergenic
1133921811 16:10160230-10160252 ACATTGTTTTGAGGGAGAGTAGG - Intronic
1133946354 16:10352028-10352050 TCTTACTTTTGTGGGAGGGTAGG - Intronic
1134259673 16:12640854-12640876 TCTGTAGTATGAGGGAGTGAAGG + Intergenic
1134299179 16:12974384-12974406 TCTGTGTTTTTAGGGAGTCTTGG - Intronic
1135702976 16:24649134-24649156 TATTTATTTTGAGGCAGAGTAGG - Intergenic
1137038421 16:35587554-35587576 TTTTTTTTTTGAGAGAGGGTAGG + Intergenic
1137541504 16:49365299-49365321 TCTTTCTTTTCAGGGAGTATTGG + Intergenic
1138269160 16:55682457-55682479 TCTATAGTTAGAGGGATTGTTGG + Intronic
1138854218 16:60668244-60668266 TTTATTTTTTGGGGGAGTGTGGG + Intergenic
1139398083 16:66656800-66656822 TGGTTATTTTGTGGTAGTGTCGG - Intronic
1140218678 16:73028125-73028147 TCCTTTTTTTGGGGGAGTGTGGG + Intronic
1140568302 16:76070923-76070945 TTTTGATTTTGTGGAAGTGTTGG + Intergenic
1140711355 16:77680886-77680908 TATTTATTTTGCAGGAGCGTGGG + Intergenic
1140767178 16:78170985-78171007 TATTTATTTTGTGGGAGTGAAGG + Intronic
1142361316 16:89628783-89628805 TCTTTATTTTAAAGGTTTGTGGG + Intronic
1142587349 17:981773-981795 TATTTATTTTGAGACAGTGTGGG + Intergenic
1144512366 17:15887939-15887961 TTTTTTTTTTGATGGAGTCTTGG - Intergenic
1145355408 17:22142009-22142031 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1145977053 17:28990076-28990098 TCTTTTTTTTGTGTGTGTGTGGG - Intronic
1148067786 17:44885545-44885567 GCTTCATTTTGAGGGACAGTGGG + Intronic
1149356481 17:55845073-55845095 TTTTTTTTTTGATGGAGTTTTGG - Intergenic
1149574861 17:57704519-57704541 TTTTTATATAAAGGGAGTGTTGG + Intergenic
1149869444 17:60168824-60168846 TCAGTACTTTGAGGGAGAGTGGG + Intronic
1150909924 17:69377018-69377040 TTTTTATTTTGAGACAGTCTGGG - Intergenic
1150913870 17:69416186-69416208 ACTTTTTTGGGAGGGAGTGTGGG + Intronic
1153108519 18:1556903-1556925 TTTTTATCATGAAGGAGTGTTGG + Intergenic
1153133656 18:1887523-1887545 TCTTTACTTTGAGAGCCTGTTGG - Intergenic
1153223211 18:2879669-2879691 TCTTTTTTTGGGGGGGGTGTTGG - Intronic
1153419092 18:4884373-4884395 CCTCTATTTTGAGGTTGTGTGGG + Intergenic
1154079781 18:11244782-11244804 TCTTTTTCTTGAGGGAGATTGGG - Intergenic
1155132289 18:22950087-22950109 TCCTCACTTTGAGGGAGTCTAGG + Intronic
1155309124 18:24507058-24507080 GCTTTATGCTGAGGCAGTGTGGG - Intergenic
1157608165 18:48939380-48939402 GCTTTGTTTTGGGGGGGTGTGGG - Intronic
1158132509 18:54168784-54168806 TCTTAGCTTTGAGTGAGTGTTGG - Intronic
1158638622 18:59183002-59183024 TATATATTTTGATGGAGGGTTGG + Intergenic
1158815863 18:61096067-61096089 TATTTATTTTGAGAGAGAGACGG - Intergenic
1159321308 18:66854069-66854091 TTTTTATTATGAATGAGTGTTGG - Intergenic
1160214578 18:76917035-76917057 TTGTTACTTTGAGGGAGTTTAGG - Intronic
1160421098 18:78745485-78745507 TATTTATTTTGGTGGAGGGTAGG + Intergenic
1160742642 19:694549-694571 TTTTTTTTTTGAGGCAGTCTCGG - Intronic
1161635448 19:5385938-5385960 TCTTTTTTTTGATGGAGTCTTGG - Intergenic
1162483509 19:10943938-10943960 TTTTTTTTTAGAGGGAGTCTTGG - Intergenic
1163367201 19:16881885-16881907 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1164404477 19:27931466-27931488 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1164919506 19:32078289-32078311 TCTTTATTTTGGGGGGATGGGGG - Intergenic
1165056596 19:33180916-33180938 TCTTTATTTTGTAGGAGTTTGGG + Intronic
1165164954 19:33846230-33846252 TTTTTATTTTGGGGGAGTAGGGG - Intergenic
1165356309 19:35306202-35306224 TCTTTTTTGTGGGGGAGTGGGGG - Intronic
1165638722 19:37365635-37365657 TCCTTATGTTGAGGGAGTGCTGG + Intronic
1167496281 19:49820597-49820619 TCTCTATGTTGAGGGAGTGCTGG + Intronic
1167601507 19:50457690-50457712 TTTTTTTTTTGATGGAGTCTTGG + Intronic
1167891026 19:52539564-52539586 TTTTTTTTTTGACGGAGTTTTGG + Intronic
925029628 2:639573-639595 TCTTTATTTTGAGCAAAAGTAGG - Intergenic
925565307 2:5247171-5247193 TTTTTATTGTGAATGAGTGTGGG - Intergenic
925610605 2:5697706-5697728 TCTACATGTTGAGGGGGTGTGGG - Exonic
925684245 2:6455245-6455267 TCTTTATTTTGTGTGTGTGAGGG - Intergenic
926811046 2:16755651-16755673 TCTTTGGTTAGAGTGAGTGTGGG + Intergenic
926916276 2:17895014-17895036 TTTTTATATTGATGAAGTGTAGG + Intronic
927455514 2:23245866-23245888 TCTTTATTTTAATGCATTGTAGG - Intergenic
927587574 2:24321580-24321602 TCTTTATTTAGAAAGTGTGTAGG - Intronic
928731115 2:34234287-34234309 TTTTTATTTTTAGTGAGTTTTGG + Intergenic
929291808 2:40201100-40201122 TTTTTTTTTTGAGGGAGTGGGGG - Intronic
929718689 2:44342588-44342610 TTTTTTTTTTAATGGAGTGTAGG - Intronic
930393223 2:50787543-50787565 TCTTTTTTTAGATGGAGTTTCGG - Intronic
931841774 2:66158682-66158704 ACTCTATTTTGACTGAGTGTAGG - Intergenic
933083890 2:78030079-78030101 TCCTTATGTTGTGGGAGTGCTGG + Intergenic
933857946 2:86435910-86435932 TCTATATCTTGATGGGGTGTAGG + Intergenic
934890581 2:98065237-98065259 TCTTTTTTTTGGGGGGGTGGGGG - Intergenic
935881097 2:107566327-107566349 TTTTTTTTTTGATGGAGTCTTGG - Intergenic
936495194 2:113014476-113014498 TTTTTTTTTTGATGGAGTCTTGG + Intergenic
936625725 2:114146846-114146868 TCTTTAATGTGAGTGAGTGCTGG + Intergenic
936750891 2:115640242-115640264 TCTTTTATTTGGGGGAATGTTGG - Intronic
936871868 2:117142959-117142981 TTTTTTTTTTGAGTCAGTGTTGG + Intergenic
937242179 2:120469018-120469040 TCTGTATTTAAAGGGAGTGTTGG + Intergenic
937279571 2:120708075-120708097 TCTTGATTTTCAGGGAGTGTGGG + Intergenic
937605314 2:123793444-123793466 CCATTACTTTGAGGGACTGTTGG + Intergenic
938272063 2:129981170-129981192 TGTTTGTTTTGAGGAAGTGGGGG - Exonic
938443946 2:131362643-131362665 TGTTTGTTTTGAGGAAGTGGGGG + Intergenic
938937393 2:136138918-136138940 TCTTTGTTTTGAGGGACTCAGGG + Intergenic
940620152 2:156102332-156102354 TTTTTATCATGAGTGAGTGTTGG - Intergenic
941341110 2:164304641-164304663 CCTTTATTGTGAAGGAATGTTGG - Intergenic
941344001 2:164345019-164345041 TCCTTTATTTCAGGGAGTGTAGG + Intergenic
942041052 2:172063262-172063284 TGTTCATTTTGAGAGGGTGTTGG + Intronic
942110802 2:172680921-172680943 TCTTTCTTTTTAGTGACTGTTGG + Intergenic
942604226 2:177673540-177673562 TCTGTATTTTGGGTGTGTGTAGG + Intronic
944158516 2:196634487-196634509 TTTTTTTTTTTAGTGAGTGTAGG - Intergenic
945309233 2:208291197-208291219 TTTTTATAATGAAGGAGTGTTGG + Intronic
946664763 2:222036989-222037011 TCTGAAGTTTGGGGGAGTGTGGG - Intergenic
947173133 2:227332565-227332587 TCTTCATTTTGAGGGGTTGTAGG - Exonic
947653889 2:231810081-231810103 CCTTTATTTTGAGGGAGGGAGGG + Intergenic
948723344 2:239917348-239917370 TCCCTATGTTGAGGGAGTGCTGG - Intronic
949052890 2:241906714-241906736 TCCCTATATTGAGGGAGTGCTGG + Intergenic
1169463896 20:5820973-5820995 TCTTTATTTTATGGGACTTTAGG - Intronic
1169660696 20:7975450-7975472 TCTTTTTTTTGAGGGAGGGATGG - Intergenic
1169860205 20:10143282-10143304 ACTTAATTTTGAGGTAATGTTGG - Intergenic
1169981066 20:11384426-11384448 CCTTTAGTTTGGGGTAGTGTAGG - Intergenic
1170774239 20:19361537-19361559 TCTTTATTTTGATAGAGCTTTGG + Intronic
1171410651 20:24945306-24945328 TTATTATTGTGTGGGAGTGTAGG - Intergenic
1172965388 20:38830617-38830639 TCTTTGTTTTGAAGGAGGATTGG + Intronic
1174027255 20:47588149-47588171 TTTTTTTTTTGAGGCAGTCTTGG + Intronic
1175039414 20:56032861-56032883 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1176177111 20:63733911-63733933 CCTTTATCTTCAAGGAGTGTGGG + Intronic
1177471842 21:21569921-21569943 TCTTTATTTTGGGAAAGTGGGGG - Intergenic
1177873057 21:26596802-26596824 TTTTTAATTTGAGGGAGTGGTGG - Intergenic
1178002323 21:28176225-28176247 TTTTTTTTTTGACGGAGTCTTGG - Intergenic
1178413451 21:32384665-32384687 TCTTTATTTTGCTGGACTATGGG - Intronic
1178677204 21:34641340-34641362 TTTCTATGTTGAGGGAGTGCTGG - Intergenic
1179092066 21:38275507-38275529 TTTTTTTTTTGACGGAGTTTCGG - Intronic
1179219909 21:39396853-39396875 TCTTTGTTTTCAGGTGGTGTTGG + Exonic
1180894164 22:19316210-19316232 TCCTTATGTGGAGGGAGTGCTGG - Intergenic
1181626010 22:24122693-24122715 TTTTTTTTTAGAGGGAGTTTTGG - Intronic
1181963620 22:26641097-26641119 TCTTTATTTTGGAAGAGTTTGGG - Intergenic
1183156804 22:36082083-36082105 TTTTTTTTTTGAGAGAGTCTTGG + Intergenic
1183908513 22:41061230-41061252 TCTTTTTTTTGGGGGGGTGGAGG + Intergenic
1184024766 22:41847088-41847110 TCTTTAGTTTTAGGGAGATTTGG + Intronic
951403862 3:22269710-22269732 TCTTTTTTTGGGGGGAGGGTAGG + Intronic
951712427 3:25597920-25597942 TATTTATTTTAAAGGTGTGTGGG + Exonic
952433111 3:33245282-33245304 TCATTTGTTTGAGGTAGTGTTGG - Intergenic
953273269 3:41467845-41467867 TCTATACTTTGATGGGGTGTTGG + Intronic
953766961 3:45750342-45750364 TCCTTCTTTGGAAGGAGTGTTGG + Intergenic
954082794 3:48222292-48222314 TCTTAATATTGAGAGCGTGTGGG - Intergenic
954591235 3:51784501-51784523 TTTTTATCATGAGAGAGTGTTGG + Intergenic
954848490 3:53580174-53580196 GCTTTCTTTTGAGGGAGTTGTGG + Intronic
955103589 3:55875132-55875154 GCTTTATTATAAGGCAGTGTGGG - Intronic
955956107 3:64291889-64291911 TCTTTTTTTTGGGGGGGTGGGGG - Intronic
956760403 3:72438348-72438370 TTTTTTTTTAGAGGGGGTGTGGG + Intronic
957182879 3:76903682-76903704 TCTTTATTTTGAGGGAACCAGGG + Intronic
958513671 3:95083250-95083272 AATTTATTTTGGGGGATTGTGGG - Intergenic
958794777 3:98695319-98695341 TATTTTTTTTGAGAGAGTTTGGG - Intergenic
959248565 3:103908001-103908023 TTTTTTTTTTGAGGGGGGGTGGG - Intergenic
959435526 3:106310595-106310617 TCTTTTATTTGAAAGAGTGTTGG - Intergenic
959819064 3:110710586-110710608 TCTTTGTTTTGAGTCAGTGAAGG + Intergenic
959962313 3:112312426-112312448 TCCTTATGTTGAGAGAGTGCTGG - Intergenic
960145841 3:114201235-114201257 TTTTTATTTTAAGGTATTGTAGG + Intergenic
960402982 3:117226623-117226645 TTTGTATTTTGAGGGGGTGGGGG - Intergenic
960683002 3:120268524-120268546 GCTTTTTTTTGCGGGGGTGTGGG + Intronic
960724481 3:120656554-120656576 TCTTTTTTTTGGGGGGGGGTTGG + Intronic
960837099 3:121917994-121918016 ACTTTATTGTGAGGGAGAGTGGG + Intronic
962634196 3:137313376-137313398 ACTTTTTTTTGGGGGAGAGTGGG + Intergenic
962656936 3:137556644-137556666 TTTTTATCATGAAGGAGTGTTGG - Intergenic
962782326 3:138731257-138731279 TCTTTTTTTTGGGGGAGATTGGG + Intronic
963902208 3:150743487-150743509 TCTTGAATCTGAGGAAGTGTTGG - Intronic
964408581 3:156375822-156375844 TCTTTTTTTTGTGTGTGTGTTGG + Intronic
964487508 3:157200751-157200773 TCTATCTTTTGAGAGAGCGTTGG + Intergenic
964691648 3:159456301-159456323 TCTCTATGTTGAGGGAATGATGG + Intronic
964775822 3:160275913-160275935 TATTTATTTAGATGGAGTCTCGG + Intronic
964786687 3:160403003-160403025 ATTTTATTTTGGGGGAGTGGTGG + Intronic
965303728 3:167037417-167037439 TCTTAATTTTGAGGGTGCTTAGG + Intergenic
965404765 3:168255259-168255281 TTTAGATTTTGAGGGACTGTTGG - Intergenic
965767198 3:172143377-172143399 ACTTTATTTTGGGGGAGAATAGG + Intronic
966206024 3:177407409-177407431 TCATCATTTAGAAGGAGTGTTGG + Intergenic
966456938 3:180128143-180128165 GCTTTTTTTTGGGGGGGTGTGGG - Intergenic
966777341 3:183554592-183554614 TCTTTATGTGTAGGCAGTGTGGG - Intronic
967036065 3:185649079-185649101 TCTCTGTTTTCAGGGAGTGGAGG + Intronic
968681667 4:1925180-1925202 TTTTTATTTTTCGGGAGTGCTGG + Intronic
971278853 4:25224407-25224429 TCCTTATGTTGAGGGAGTGCTGG + Intronic
972705945 4:41542644-41542666 TACTTATCTTAAGGGAGTGTTGG - Intronic
972715165 4:41638665-41638687 TCTTTCTTTTTGGGTAGTGTGGG + Intronic
973155908 4:46952035-46952057 TCTCTCTTTTGAGGGTGGGTTGG - Intronic
973817349 4:54631326-54631348 TCTTTACTTTGAGGGTTTATGGG + Intergenic
975048777 4:69832919-69832941 TCTCTATATTGAGGGAGTGCTGG + Intronic
975167832 4:71197852-71197874 TCTCTATTTTGGGGGGTTGTGGG + Intronic
975340841 4:73238225-73238247 ACTTTCTTTTGAGGGAGGTTAGG - Intronic
975630841 4:76400596-76400618 TCTTTTTTTTGGGGGGGTGGTGG - Intronic
976125192 4:81826989-81827011 TCTTTGTTTTGAGGGCACGTGGG + Intronic
976196125 4:82533059-82533081 TCATTGTTTTGTGGCAGTGTGGG - Intronic
976250011 4:83040769-83040791 TTTTTTTTTTGAGGGAGGGTTGG + Intronic
976254634 4:83087411-83087433 TTTTTATCTTGAATGAGTGTTGG - Intergenic
977150714 4:93508208-93508230 TTTTTTTTTTGACGGAGTCTTGG + Intronic
977665866 4:99646732-99646754 TATTTGTTTTGAGGTAGGGTAGG - Intronic
978053460 4:104233403-104233425 ACTATTTTTTGAGGGAGTATGGG - Intergenic
978058417 4:104304094-104304116 TTTTAATCATGAGGGAGTGTGGG - Intergenic
978138123 4:105288324-105288346 TTTTTTTTTTGAGGGTGAGTGGG + Intergenic
978533346 4:109736183-109736205 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
978685999 4:111444379-111444401 TTTTTATTTTGAAGGAATATTGG + Intergenic
979185629 4:117788354-117788376 TATTTATCATGAAGGAGTGTTGG + Intergenic
979410567 4:120373481-120373503 TCTTTTTTTTGGGGGGGTGGCGG + Intergenic
979679420 4:123443528-123443550 TCTCTTTTTTGAGGGGGTGGAGG - Intergenic
979826543 4:125241827-125241849 TCTTTCTTTTAAAGAAGTGTGGG - Intergenic
980587817 4:134840680-134840702 TTTTAATGTTGAGGGACTGTAGG + Intergenic
980627852 4:135397258-135397280 TCTTTATTTTGTGGGATTTGTGG + Intergenic
980637992 4:135535104-135535126 TCTTTATTTCAAGTGAGTCTGGG - Intergenic
980645077 4:135633697-135633719 CCTTTATTTTGAGCAAGTGTTGG + Intergenic
980663032 4:135891924-135891946 TCTTATTTTTGTGGGAGTGCTGG + Intergenic
981026979 4:140086641-140086663 TCTATATTATGAGAGAGAGTAGG - Intronic
981109022 4:140914132-140914154 TCTTCATTTTGTGGGATAGTAGG + Intronic
981536101 4:145801502-145801524 TCTTTCTTTTTAGAGAGAGTGGG + Intronic
981720833 4:147799902-147799924 TCTTTTTTTTGGGGGGGTGCGGG + Intronic
981766010 4:148250947-148250969 TCTTTTTTTTGGGGGGGAGTGGG + Intronic
981787132 4:148492074-148492096 TCTTTTTTTTGGGGGGGGGTGGG + Intergenic
982819281 4:159926446-159926468 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
983473868 4:168191096-168191118 TTTTTATCATGAGGGAGTGTTGG - Intergenic
983552794 4:169034410-169034432 TCTTTATTTTGAGGGAACTGTGG - Intergenic
984203330 4:176754932-176754954 TCTGTATTTTCAGGAATTGTAGG - Intronic
984330227 4:178305734-178305756 TCTTTTTTTTGGGGGGGTGAAGG - Intergenic
985292892 4:188404618-188404640 TCTTTTTTTGGAAGGAGGGTGGG + Intergenic
985312141 4:188614091-188614113 CCTTTTTTTTGTGGGATTGTTGG - Intergenic
985316687 4:188665551-188665573 TCTTTCTTTTCAGTGGGTGTTGG + Intergenic
986888794 5:12274671-12274693 TATATACTTTGAGGGAATGTTGG - Intergenic
987573800 5:19701552-19701574 TCTAAATTTTGAGGGAATATGGG - Intronic
989177582 5:38543959-38543981 GCTATATTTTGAGAGGGTGTAGG - Intronic
990006338 5:50947706-50947728 ATATTATTTTGAGGGAGAGTAGG - Intergenic
990047545 5:51452586-51452608 TCTTTGTTTTGAGTGGGAGTGGG - Intergenic
991117287 5:62969528-62969550 GCTTTATTTAGAGGGACTGTGGG - Intergenic
993036699 5:82767015-82767037 TTTTTTTTTTGTGGGAGTGGTGG + Intergenic
994458509 5:100046457-100046479 GCTTTATTTTTATGGAGTGTGGG + Intergenic
994760285 5:103843505-103843527 TTTTTATTTTGAGGTAGAGCTGG + Intergenic
995194291 5:109346345-109346367 TTTTAATTTTGAGGAATTGTTGG - Intronic
996422996 5:123282751-123282773 TCTTGGTTTTGAGGCAATGTAGG + Intergenic
997285380 5:132674333-132674355 TCTTTTTTCTGAGGGTTTGTAGG + Intronic
997971728 5:138408378-138408400 TTTTTTTTTTTAAGGAGTGTAGG - Intronic
998101056 5:139435056-139435078 TTTTTATTATGAAAGAGTGTTGG + Intronic
999215592 5:149932316-149932338 TCTTCATTTTGAGGGGTTGTAGG + Intronic
1001200872 5:169715330-169715352 TCTGTGTTTTGAGGGATTATAGG + Intronic
1001852107 5:174977327-174977349 TCTTTATTGGGAGTGAGAGTAGG - Intergenic
1003027856 6:2573376-2573398 TATTTATTTTGAATGAGTGGTGG + Intergenic
1003213976 6:4091954-4091976 TCGCTATGTTGAGGGAGTGCTGG - Intronic
1003228102 6:4224561-4224583 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1003849658 6:10208872-10208894 TCTCTATGTTGAAGGAGAGTGGG - Intronic
1004741720 6:18468072-18468094 TCTGTATTGAGAGGAAGTGTGGG + Exonic
1005316793 6:24610764-24610786 TTTTTGTTTTGAGGGAGGCTTGG - Intronic
1005949878 6:30624079-30624101 TGTTTTTTTTGGGGGGGTGTGGG + Intronic
1006384423 6:33721875-33721897 TATTTATTTTGGGGGTGGGTTGG - Exonic
1006564414 6:34942743-34942765 TATTTACTCTTAGGGAGTGTGGG + Intronic
1006888447 6:37402039-37402061 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1007199430 6:40093949-40093971 TTTTTATTGTGTGGGAGTCTAGG + Intergenic
1007434137 6:41796347-41796369 TCTTTCTTTTGAATGAGTTTGGG - Exonic
1008202777 6:48612757-48612779 TGTTTATTGGGAGAGAGTGTAGG - Intergenic
1010202225 6:73292411-73292433 TCTTTATTTTTTCAGAGTGTTGG + Intronic
1010948863 6:82011051-82011073 TCTTTATTTTGAGTTGATGTGGG - Intergenic
1011036670 6:82984619-82984641 TCTTTATTAGGAGTGAGGGTGGG + Intronic
1011043989 6:83061791-83061813 TGTTTATTTTCATGGAGAGTAGG + Intronic
1011504960 6:88031282-88031304 TCCTTATTTTGAGAGAGTGCTGG - Intergenic
1012518799 6:100095335-100095357 TCTTTATTGTGCGGGAGAGGTGG - Intergenic
1012535996 6:100298044-100298066 TCTTGATGAAGAGGGAGTGTTGG - Intergenic
1012979636 6:105816074-105816096 TCATCATTTTCAGGGAGTGAGGG + Intergenic
1013254035 6:108365858-108365880 TCTCTTTTTTGAGGGGGTGTGGG + Intronic
1013306988 6:108857685-108857707 TTTTTATTATGAATGAGTGTTGG + Intronic
1014967420 6:127772835-127772857 TTTTCATTTTGAGGGCGTTTGGG + Intronic
1016196124 6:141343480-141343502 TTTTTATTTTGAGTGTATGTTGG + Intergenic
1016339458 6:143046716-143046738 TCTTTATTATGAATGCGTGTTGG - Intergenic
1016808783 6:148239347-148239369 TGTTTTTCTAGAGGGAGTGTTGG + Intergenic
1017091954 6:150767129-150767151 TCTTTATTTTGAGGGAGTGTAGG + Intronic
1019331355 7:462338-462360 TCTTTAGTGTGAGGGAGGCTGGG - Intergenic
1019725862 7:2602372-2602394 TCTTTATTTTGCTGGAGTCCTGG + Intronic
1020498627 7:8888882-8888904 TTTTTATTTTGAGATACTGTGGG + Intergenic
1020686003 7:11296066-11296088 TCATTATTTTCAAAGAGTGTTGG - Intergenic
1020862078 7:13506154-13506176 TCTTCATTTTGGGGGAGTGGAGG + Intergenic
1022363019 7:29681357-29681379 TTCTTATATTGAAGGAGTGTGGG - Intergenic
1022428295 7:30289242-30289264 TTCTTATATTGAAGGAGTGTGGG + Intronic
1022698374 7:32732430-32732452 TTCTTATATTGAAGGAGTGTGGG + Intergenic
1022767351 7:33428542-33428564 TCTTCAGTTTGAGGGGGTGGAGG - Intronic
1024423614 7:49199979-49200001 TCTGTATGTTGAGGGAGTGCTGG - Intergenic
1024876573 7:54031315-54031337 CCTTTATTTTGAGGTAATATAGG + Intergenic
1026772609 7:73211913-73211935 CCTTAATTTTGAGGAAGTGTTGG + Intergenic
1027013473 7:74765313-74765335 CCTTAATTTTGAGGAAGTGTTGG + Intergenic
1027074565 7:75180720-75180742 CCTTAATTTTGAGGAAGTGTTGG - Intergenic
1027288201 7:76672319-76672341 TTTTTTTTTTGAGGGGGTGAGGG - Intergenic
1028131365 7:87178206-87178228 TCTTAATTTTGACGCTGTGTGGG + Intronic
1030174860 7:106641925-106641947 TCTATATTTTGATGGGGTGGTGG + Intergenic
1032451948 7:132039297-132039319 ATTTTATATTGAGGAAGTGTTGG + Intergenic
1032465813 7:132144127-132144149 TCATTCTTCTGAGGCAGTGTGGG - Intronic
1032670497 7:134077950-134077972 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1032971564 7:137170189-137170211 TCTGAATTTTCAGGAAGTGTTGG + Intergenic
1033370889 7:140706659-140706681 TCTTTTTTTTGGGGGGGGGTGGG + Intronic
1034571174 7:151957900-151957922 TCTGTGTTTTGTGGGAGTATAGG + Intronic
1034834926 7:154343416-154343438 TCTTGATTTTGAGACAGTTTGGG + Intronic
1035104097 7:156427887-156427909 TCTTTATTTCCAGAGATTGTAGG - Intergenic
1036046236 8:5144129-5144151 TCTTTACTTGGAGGAAGTGAAGG - Intergenic
1037693006 8:21198521-21198543 TCTTTTTTTTGAGGTTCTGTGGG - Intergenic
1037886188 8:22597673-22597695 TCTTACTTTGGAGGGAGTCTGGG + Intronic
1038836021 8:31124396-31124418 TTTTTATCTTGATGGGGTGTGGG + Intronic
1039101536 8:33946958-33946980 TCTTCAGTTGCAGGGAGTGTGGG + Intergenic
1039665738 8:39525031-39525053 TCTTTTTTAAGAGGGAGTCTTGG - Intergenic
1039675490 8:39661163-39661185 TTTTTTTTTTGAGGGAGTCTCGG + Intronic
1040504879 8:48038326-48038348 TATTTATTTTGAGACAGAGTCGG + Intronic
1041224498 8:55685161-55685183 TCTTGATCATGAGGGAGTGAAGG + Intergenic
1042797475 8:72680286-72680308 ACCTCAGTTTGAGGGAGTGTGGG + Intronic
1042929975 8:74003676-74003698 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1043624094 8:82233046-82233068 TTTTTTTTTTGATGGAGTATGGG + Intergenic
1043652198 8:82610367-82610389 TTTTTATTTTGAAGGGATGTTGG + Intergenic
1044048521 8:87469071-87469093 TCTTTATTTTAGGGGTTTGTGGG - Intronic
1044734661 8:95267879-95267901 TTTTTTTTTTGAGGGGTTGTGGG + Intronic
1044749218 8:95400316-95400338 TTTTTTTTTTGACGGAGTCTTGG + Intergenic
1044988105 8:97772855-97772877 TCTTTTTTTTGATGGAATTTCGG - Intergenic
1045092492 8:98760711-98760733 TCTTTTTTTTGAGGGGGTGGGGG + Intronic
1045116509 8:98988709-98988731 TCTTGACTTAGAGGGAATGTTGG - Intergenic
1046244626 8:111543081-111543103 TCTGATTTTTGGGGGAGTGTGGG - Intergenic
1046670061 8:117047150-117047172 TTTTCCTTTGGAGGGAGTGTGGG + Intronic
1046704318 8:117433914-117433936 TCTTTTTTTTGGGGGGGGGTGGG + Intergenic
1047398826 8:124528798-124528820 TCCTTATGTTGAGGGAGTGCTGG - Intronic
1048105431 8:131403384-131403406 TGTTTATTTTAGGGGATTGTAGG - Intergenic
1048617698 8:136095873-136095895 TATTTTTGTTGAGGAAGTGTGGG + Intergenic
1050206360 9:3200488-3200510 TCATGATTCTGAAGGAGTGTTGG + Intergenic
1050527928 9:6562400-6562422 TCTTTTTTGAAAGGGAGTGTGGG - Intronic
1050564985 9:6872739-6872761 CCTTTATTTTGAGCCTGTGTGGG + Intronic
1050799935 9:9598110-9598132 TCTTGGTTTTGAAGGAGTGTTGG - Intronic
1051168114 9:14287414-14287436 TTTTTTTTTTGACGGAGTCTCGG - Intronic
1052139001 9:24954784-24954806 TTTTTTTTTTGACGGAGTCTCGG + Intergenic
1052168256 9:25359990-25360012 TTTTTATAATGAGGGAGTGTTGG + Intergenic
1052221094 9:26023417-26023439 TCATTCTTATGAGGGTGTGTGGG + Intergenic
1053301583 9:36956007-36956029 TGTTTGTTTTGAGGGTGTGTCGG - Intronic
1055092943 9:72381098-72381120 TGTTTGTTTTGAGGGAAGGTGGG + Intergenic
1055379075 9:75686554-75686576 TATTTAGTTTGCTGGAGTGTGGG + Intergenic
1056501602 9:87215154-87215176 TCTTTATTTGGTGGGAGTACTGG - Intergenic
1056578648 9:87874182-87874204 TCCTTATGTTGAGGGAGTGCTGG - Intergenic
1057248295 9:93478089-93478111 TCCTTATTTTTAGGAAGTGATGG - Intronic
1057849117 9:98550936-98550958 TTTTTTTTTTGAGTGAGTGTAGG - Intronic
1058302046 9:103387588-103387610 TCTTTATTTATATGTAGTGTTGG + Intergenic
1058490843 9:105497066-105497088 TTTTTATTTTGAATGAGTGTTGG + Intronic
1059954123 9:119498272-119498294 CTTTTATTTGGAGGGAGTGGTGG + Intronic
1060097519 9:120805362-120805384 TCCTGATGTTGAGGGAGTGCTGG + Intergenic
1062112097 9:134787710-134787732 GCTTTATTTAAAGGGATTGTGGG + Intronic
1185983535 X:4805940-4805962 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1186087219 X:6003542-6003564 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1187000880 X:15176351-15176373 ACTTTATTTTGTGGGTGTTTAGG - Intergenic
1187274040 X:17803179-17803201 TCTTTCTTTGGAGGTTGTGTTGG - Intronic
1187348547 X:18489889-18489911 CTATTATTTTGAGGGAGAGTTGG - Intronic
1187379896 X:18791879-18791901 TTTTTATTGTGAAAGAGTGTTGG + Intronic
1187699583 X:21952308-21952330 TGTTTATCTTGAATGAGTGTTGG + Intronic
1187919436 X:24186452-24186474 TCTTTTTTTTGGGGGGTTGTGGG - Intronic
1188050589 X:25480502-25480524 TTTTTTTTTTGACGGAGTCTCGG + Intergenic
1189523070 X:41790539-41790561 CCTTTATTTTGAGAGTGGGTAGG - Intronic
1190535046 X:51417646-51417668 TCCTTACGTTGAGGGAGTGCTGG + Intergenic
1191027237 X:55927046-55927068 CTTTTATATTCAGGGAGTGTTGG - Intergenic
1191645369 X:63474910-63474932 TCCTTATGTTGAGGGAGTGCTGG - Intergenic
1191760259 X:64639424-64639446 TTTTTATCATGAGGGAATGTTGG + Intergenic
1192097434 X:68227283-68227305 TTATTATTTTGTGGGAGTCTAGG - Intronic
1192349017 X:70339749-70339771 TATTTATTTTCTGTGAGTGTCGG + Intronic
1193064171 X:77240188-77240210 TCTGTTTTTTGAGGGATTTTTGG - Intergenic
1193292847 X:79796796-79796818 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1193382282 X:80828676-80828698 TGTTTATCATGAAGGAGTGTTGG - Intergenic
1193906052 X:87245390-87245412 TCTTTATTTTGAGAGAGGTAAGG + Intergenic
1194880621 X:99246978-99247000 TTTTTATTGTGAAGGAATGTTGG - Intergenic
1195737086 X:108023164-108023186 CTTTTATTATGAAGGAGTGTTGG + Intergenic
1195807997 X:108796923-108796945 TGTTTTTTTTGGGGGGGTGTGGG + Intergenic
1196196424 X:112841679-112841701 TATTAATTTTGAGGGCGGGTGGG - Intergenic
1196213768 X:113026595-113026617 TTTTTATCATGAAGGAGTGTTGG - Intergenic
1196657139 X:118230068-118230090 TCTTTTTTTTGAGGGGGAGGAGG - Intergenic
1197110368 X:122766158-122766180 CTTTTTTTTGGAGGGAGTGTAGG - Intergenic
1197322177 X:125045996-125046018 TCCTTATTTGGAGGTAGTTTGGG + Intergenic
1197360224 X:125492637-125492659 TCCTTATGTTGAGAGAGTGCTGG - Intergenic
1197743521 X:129914581-129914603 TCTTTTTTTTGGGGGAGGGCGGG - Intronic
1197802721 X:130368395-130368417 TCTTTCTTTTGTGTGTGTGTGGG - Intronic
1198735550 X:139781078-139781100 TCTTTTTTTGGAGGGTGGGTCGG - Intronic
1198777110 X:140191778-140191800 TCTTTTTTTTCAGGTTGTGTTGG - Intergenic
1200415209 Y:2902819-2902841 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1200783709 Y:7239819-7239841 GCTCTATTTTGGGGGAGCGTGGG - Intergenic
1201264905 Y:12196680-12196702 TCTGTATGCTGAGGGAGTGCTGG - Intergenic
1201428291 Y:13878603-13878625 TCCCTATATTGAGGGAGTGCTGG + Intergenic
1201502935 Y:14665381-14665403 TCTTTATTGTGAAGGAGTTCTGG - Intronic
1201540970 Y:15104056-15104078 TCTTTTTTTTGGGGGGGTGGGGG + Intergenic