ID: 1017094886

View in Genome Browser
Species Human (GRCh38)
Location 6:150796059-150796081
Sequence CACCCAGATATGGATCCGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 35
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 32}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017094886 Original CRISPR CACCCAGATATGGATCCGTC TGG Intronic
905380658 1:37559342-37559364 CACGCAGCTATGGATCCAGCAGG + Exonic
917083810 1:171285304-171285326 GAGCCAGATGTGGATCCGTTAGG - Exonic
1082923901 11:58525531-58525553 CACACAGATACGGAACCATCTGG - Intergenic
1084915162 11:72423296-72423318 CACCGAGATGTGGATCCCTGAGG - Intronic
1094424790 12:30306316-30306338 CAACCAGATGTGGGTCCCTCAGG + Intergenic
1114777408 14:25499584-25499606 CAGCTAGAGATGGATCCGTGTGG + Intergenic
1120542330 14:85765722-85765744 TACCCAGAGATGGATCTGTCGGG + Intergenic
1123116240 14:105895364-105895386 CAGCCAGACATGGCTCCGTGGGG - Intergenic
1128809930 15:70563370-70563392 CTTCCAGATGTGGAACCGTCAGG + Intergenic
1135348778 16:21711422-21711444 CTCCCAGATTTGGAGCCCTCTGG - Intronic
1137069897 16:35895005-35895027 CAGCCAGATCTGGTTCAGTCTGG + Intergenic
1150219444 17:63487790-63487812 CACCCAGAAATGGGTCTTTCTGG + Intronic
1154367350 18:13723309-13723331 CACCCAAATTTGAATCAGTCAGG + Intronic
1160504332 18:79418519-79418541 CACCAAGATGTGGAGCCTTCTGG + Intronic
1160853889 19:1207308-1207330 CACCCTGAGCTGGACCCGTCTGG + Intronic
1162044499 19:7989458-7989480 CACCTAGATTTGGCTCAGTCTGG - Intronic
926745436 2:16153048-16153070 TGCCCAGATATGGATCTTTCTGG - Intergenic
931170463 2:59798096-59798118 CACTCAGTTATGGATACATCTGG + Intergenic
934756899 2:96830579-96830601 CACCCAGATCTGGAGCCCACAGG - Intronic
948691157 2:239706030-239706052 CACCCAGATGTGAATCCCCCAGG - Intergenic
951104831 3:18730576-18730598 CACACAGATATGGCTCCACCTGG + Intergenic
952287432 3:31981711-31981733 CACCCGGATATGGACCCGCCCGG + Intronic
964245471 3:154647716-154647738 AACTCAGCTATGAATCCGTCTGG - Intergenic
978155025 4:105479892-105479914 CATACAGGTATGGATCTGTCAGG - Intergenic
980501127 4:133655797-133655819 CACCCTGAGATGGGACCGTCTGG - Intergenic
990961245 5:61395441-61395463 TACACAGATATGGATCTATCAGG + Intronic
992927044 5:81598881-81598903 AACCCAGATATGCTTCCCTCTGG + Intronic
1008557435 6:52687663-52687685 CATCCAAATATGAATCCTTCTGG - Intergenic
1010786688 6:80010734-80010756 CACCCAGATACGTATTCATCAGG - Intronic
1017094886 6:150796059-150796081 CACCCAGATATGGATCCGTCTGG + Intronic
1032992728 7:137411815-137411837 CACTCAGAAATGCATCCTTCAGG - Intronic
1056091321 9:83208436-83208458 CACCCAGAAATGGTTACTTCTGG - Intergenic
1057556368 9:96091382-96091404 CACCTAGAAATGGAGCCATCAGG + Intergenic
1188916634 X:35919756-35919778 AAAACAGATGTGGATCCGTCCGG - Exonic
1199850909 X:151724530-151724552 CACCCAGATATGAGTACTTCTGG + Intergenic