ID: 1017097645

View in Genome Browser
Species Human (GRCh38)
Location 6:150818983-150819005
Sequence TCCCACCATCGCTGCAGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 244}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017097641_1017097645 20 Left 1017097641 6:150818940-150818962 CCCAGGGGGAAAAGCAGCATCAG 0: 1
1: 0
2: 1
3: 27
4: 258
Right 1017097645 6:150818983-150819005 TCCCACCATCGCTGCAGCTGAGG 0: 1
1: 0
2: 0
3: 19
4: 244
1017097640_1017097645 21 Left 1017097640 6:150818939-150818961 CCCCAGGGGGAAAAGCAGCATCA 0: 1
1: 0
2: 3
3: 27
4: 218
Right 1017097645 6:150818983-150819005 TCCCACCATCGCTGCAGCTGAGG 0: 1
1: 0
2: 0
3: 19
4: 244
1017097642_1017097645 19 Left 1017097642 6:150818941-150818963 CCAGGGGGAAAAGCAGCATCAGC 0: 1
1: 0
2: 3
3: 28
4: 250
Right 1017097645 6:150818983-150819005 TCCCACCATCGCTGCAGCTGAGG 0: 1
1: 0
2: 0
3: 19
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017097645 Original CRISPR TCCCACCATCGCTGCAGCTG AGG Intronic
901396939 1:8988518-8988540 GCCCACCGTCCCTTCAGCTGTGG - Intergenic
901634819 1:10665566-10665588 CTCCTCCATCCCTGCAGCTGAGG - Exonic
902186078 1:14726409-14726431 TCCCAGCATCTCAGCAGGTGTGG + Intronic
902610296 1:17593169-17593191 TCCCTGCATCCCTGCAGCGGTGG + Intronic
903082237 1:20820136-20820158 TCCCACCCAAACTGCAGCTGTGG + Intronic
904349812 1:29897863-29897885 TCCCACCATAGCTGCTTCTATGG - Intergenic
905537298 1:38732508-38732530 TACCACCATCAATTCAGCTGGGG + Intergenic
906036537 1:42753971-42753993 TCCCACCATCCCTGCCCATGAGG - Intronic
907484935 1:54770937-54770959 TCCCATCATCGTTCCAGATGAGG - Intergenic
907515324 1:54990101-54990123 TCCCAGCATCCTTGCAGATGAGG - Intronic
908774231 1:67624987-67625009 TCCCAGCTTCCCTGCAGCTGGGG - Intergenic
910786000 1:90998460-90998482 TCCCAACAGACCTGCAGCTGAGG + Intronic
912478269 1:109957012-109957034 TCCCACCATCTGTGCAGGTGAGG - Intergenic
912712251 1:111958330-111958352 TCCTACCTTGGCTGCAGCTCAGG - Intronic
912962996 1:114212686-114212708 TCCCACCTTCCTTGCAGCTAGGG - Intergenic
914796594 1:150925213-150925235 TCCCAGCAACTCCGCAGCTGAGG - Intergenic
915642119 1:157236049-157236071 TCTCACCATAGCTGAAACTGAGG - Intergenic
915736601 1:158089296-158089318 ACACACCATCTCTGCAGGTGTGG - Intronic
917104431 1:171478206-171478228 CCCCACCATCCCTGCAAATGTGG + Intergenic
917143218 1:171858729-171858751 TCCCATTATTTCTGCAGCTGAGG + Intronic
922388709 1:225115222-225115244 GGCCACCATCACTGGAGCTGTGG + Intronic
922691267 1:227693397-227693419 ACCCACCTCTGCTGCAGCTGCGG + Intergenic
923190616 1:231616837-231616859 TCCCAACCTCTCTGAAGCTGAGG - Intronic
923688843 1:236173850-236173872 TCCCTCTATGCCTGCAGCTGTGG - Intronic
924639240 1:245817311-245817333 TTCCAACAGCCCTGCAGCTGAGG + Intronic
1063381598 10:5589317-5589339 GCCCACCAGTGCTGCAGATGTGG - Intergenic
1064757045 10:18580715-18580737 TGCCCCCATCTCTGCAGCAGTGG + Intronic
1066176538 10:32913075-32913097 TCCCAACAGACCTGCAGCTGAGG + Intronic
1072246239 10:93546782-93546804 CTCCACCATCACTGCAGCAGGGG + Intergenic
1074655847 10:115586981-115587003 TTCCAACAGAGCTGCAGCTGAGG - Intronic
1075211178 10:120492561-120492583 TGCCACTATCTCAGCAGCTGTGG - Intronic
1076014802 10:127019055-127019077 TCACACAATCCTTGCAGCTGGGG - Intronic
1076676271 10:132149257-132149279 TGCCACCACTGCTGCCGCTGCGG + Intronic
1079114946 11:17634932-17634954 TCTCACCACAGCTGTAGCTGGGG - Exonic
1079472398 11:20790534-20790556 TCCCTTCACAGCTGCAGCTGTGG - Intronic
1081935074 11:46898653-46898675 TCCCACCAGCCCTGCCGCTCTGG - Exonic
1084267802 11:68013908-68013930 CCCCACAATCACTCCAGCTGAGG + Intronic
1084326372 11:68402707-68402729 TCCGCCCATTGCTGCACCTGGGG + Intronic
1084451058 11:69238918-69238940 TCCCATCACAGCTGCAGCTGTGG + Intergenic
1087482337 11:98717708-98717730 TCCCAACAGACCTGCAGCTGAGG - Intergenic
1089016918 11:115172903-115172925 TCCCACCATCCCCTCAGCTGTGG - Exonic
1089468214 11:118699724-118699746 TCCCACCATCAGTGCTTCTGTGG + Intergenic
1089695862 11:120215990-120216012 TCCCTCCAGGGCTCCAGCTGTGG - Intronic
1089879823 11:121762878-121762900 TCCCTCCAGTGCAGCAGCTGAGG - Intergenic
1090982685 11:131737300-131737322 ATCCACCATCCCTGCATCTGTGG - Intronic
1091236673 11:134026767-134026789 TGCCACCACCGCTGCAGCTTCGG - Intergenic
1091360576 11:134975875-134975897 TCTCATCATCCCTGAAGCTGTGG + Intergenic
1094277443 12:28693995-28694017 TCACACCCTCTCTGCAGGTGTGG + Intergenic
1094564949 12:31590894-31590916 TGCCACCACCGCTCCGGCTGTGG + Exonic
1095912687 12:47444901-47444923 TCTCAACATGGCTGCAACTGGGG + Intergenic
1099324741 12:81200382-81200404 TCTCACCTTCTCTGCATCTGGGG + Intronic
1101223302 12:102662722-102662744 TCTCAACATGGCTGCAACTGGGG + Intergenic
1103747058 12:123132089-123132111 TCCCACTCGCTCTGCAGCTGTGG + Intronic
1104640381 12:130463251-130463273 TCCCTGCATCCCTGCAGCCGGGG - Intronic
1104919998 12:132285737-132285759 TCCTGCCATAGCTGCATCTGGGG - Intronic
1105352621 13:19629641-19629663 TCTCAACATGGCTGCAACTGAGG - Intergenic
1105424410 13:20282628-20282650 CCCCACCATCCCTGCAGGTTTGG + Intergenic
1105717493 13:23081867-23081889 TCCCACACTAGCTGGAGCTGAGG + Intergenic
1105995310 13:25665481-25665503 CCCTACCATCTCTGCACCTGAGG - Intronic
1106136390 13:26976754-26976776 TCCCACCTTCGCTGACCCTGGGG - Intergenic
1107396840 13:40026938-40026960 TTCCCCCATGGCTCCAGCTGAGG + Intergenic
1109481439 13:62960943-62960965 TCCCACTTACACTGCAGCTGAGG + Intergenic
1110155782 13:72314362-72314384 TCCCACTTGCACTGCAGCTGAGG - Intergenic
1111227135 13:85288752-85288774 TTTCACCATTGCTGGAGCTGGGG + Intergenic
1111989171 13:95099614-95099636 TCCCACCCTCAATGCACCTGAGG - Intronic
1113786452 13:113004410-113004432 TCACTCCATGTCTGCAGCTGGGG + Intronic
1114653166 14:24299582-24299604 TGCCACCTGCGCTGCCGCTGAGG + Exonic
1116422006 14:44744268-44744290 TCCCATCCCCCCTGCAGCTGTGG + Intergenic
1117083038 14:52171048-52171070 TCTCAACATGGCTGCAACTGAGG - Intergenic
1117734664 14:58756433-58756455 TGCCTCCAACCCTGCAGCTGGGG - Intergenic
1119619693 14:76122888-76122910 TCCCAGCTTCTCTGGAGCTGAGG + Intergenic
1121754592 14:96392148-96392170 TCCCACCATGGCTGAAGAAGAGG + Exonic
1122423298 14:101590738-101590760 TCCCACCAGCGATGGAGCTTTGG - Intergenic
1125089593 15:35774784-35774806 CTCCTCCATCCCTGCAGCTGAGG + Intergenic
1125826202 15:42678569-42678591 TGCCACCACCGCTGCCACTGCGG + Intronic
1126506136 15:49406540-49406562 TCCCGCCAAAGCTGCTGCTGTGG - Intronic
1128778712 15:70343353-70343375 GCCCTCCAGCTCTGCAGCTGTGG - Intergenic
1129394780 15:75237796-75237818 GCCCCCCATCCCTGCAGCTAGGG - Intergenic
1132724096 16:1331409-1331431 ACCCACCTTGGGTGCAGCTGGGG - Intergenic
1133223063 16:4327580-4327602 CTCCGCCAGCGCTGCAGCTGGGG + Intronic
1134562042 16:15219255-15219277 TCTCCCCATAGCTGGAGCTGGGG + Intergenic
1134922580 16:18130884-18130906 TCTCCCCATAGCTGGAGCTGGGG + Intergenic
1137335633 16:47546343-47546365 CCCCAACAGAGCTGCAGCTGAGG - Intronic
1138106103 16:54287794-54287816 TCCCAGCATTGCCGCGGCTGGGG + Intergenic
1138273082 16:55710063-55710085 AGCCACCATCTCTGCAGCAGAGG + Intergenic
1140771782 16:78212151-78212173 TCCCAGCAGCTCTACAGCTGAGG - Intronic
1140894223 16:79310985-79311007 TTCCACCCTGGCTGCTGCTGCGG + Intergenic
1141600783 16:85124804-85124826 TCCCACCAGTGCAGCAGCTGGGG + Intergenic
1142743326 17:1942809-1942831 TCCCACCATCCTGGCAGGTGTGG - Intronic
1144105227 17:11978364-11978386 TCCCACACTCCCTGCAGGTGGGG + Exonic
1144140514 17:12342799-12342821 TCCCCCCATCCCTCCAGCAGGGG + Intergenic
1144623842 17:16834460-16834482 TCCCACCATGCCTGCAGGTGAGG + Intergenic
1144882587 17:18438256-18438278 TCCCACCATGCCTGCAGGCGGGG - Intergenic
1145149647 17:20506130-20506152 TCCCACCATGCCTGCAGGCGGGG + Intergenic
1145357368 17:22171811-22171833 TGCCACCTGCACTGCAGCTGAGG - Intergenic
1146536699 17:33658706-33658728 CCCCACCTTGGCTGGAGCTGCGG + Intronic
1147345895 17:39794850-39794872 TTCCTCCATCACTCCAGCTGTGG + Intronic
1147578134 17:41614164-41614186 TCCCACCATGCCTGCAGGCGGGG + Intronic
1150096660 17:62381923-62381945 TTCCACCCCCGCTGCAGCAGAGG + Intronic
1150653872 17:67027094-67027116 CCCCACCATCCCTGCTCCTGCGG + Intronic
1151512594 17:74570424-74570446 CCCCACCATCGCTGCCCTTGAGG + Intergenic
1152269297 17:79314378-79314400 TCCCAGCATCACTGATGCTGAGG - Intronic
1152567182 17:81105554-81105576 TGCCACCCTCGCTGGACCTGGGG + Intronic
1154121921 18:11659115-11659137 TCACACAATAGCTGGAGCTGAGG - Intergenic
1154494715 18:14947069-14947091 TCTCATCATCCCTGAAGCTGTGG - Intergenic
1156266938 18:35497771-35497793 TCCCACAATGGCAGCAGCGGCGG - Exonic
1156841315 18:41613418-41613440 TGCTACCACCGTTGCAGCTGAGG + Intergenic
1157333750 18:46722161-46722183 TCCCACCTTCGCTGGCCCTGGGG - Intronic
1160866442 19:1258288-1258310 TCCCATCCTCGCTGCAGGAGGGG - Exonic
1161701439 19:5798107-5798129 TCCCACCTTCACTGAGGCTGAGG + Intergenic
1165717300 19:38054702-38054724 TATCACCATCACTGAAGCTGTGG - Intronic
1165792352 19:38499891-38499913 ACCCACCTTCCCTGCAGCTTTGG + Exonic
1165992855 19:39826063-39826085 TCCCACCCTCCCAGCCGCTGCGG - Exonic
1168332656 19:55579159-55579181 GCCCACCACCGCTGCAGCAGGGG - Exonic
926251741 2:11158873-11158895 TCCCCCCATCCCTGCAGCCTGGG - Intronic
927653262 2:24924943-24924965 CCCCTCCATGGCTGCATCTGGGG + Intergenic
928202206 2:29255163-29255185 TCCCACCAGCACTGCCTCTGGGG + Intronic
928399487 2:30967552-30967574 TTCCACCATCTCTGCTCCTGGGG - Intronic
931368251 2:61638078-61638100 TCCAACCTTCTCAGCAGCTGAGG + Intergenic
932622318 2:73272152-73272174 TCCCACCATCCCTGGAGCTCAGG + Intronic
932642334 2:73461370-73461392 TCCCAACAGACCTGCAGCTGAGG + Intronic
932671629 2:73742175-73742197 TCCCACTTGCACTGCAGCTGAGG + Intergenic
932740931 2:74290760-74290782 TGCCACCACCCCTGCTGCTGTGG - Intronic
936044312 2:109174417-109174439 TCCCACCCACGCCCCAGCTGTGG - Intronic
939253986 2:139718998-139719020 TACCACAATCTCTGCAGATGAGG - Intergenic
939631725 2:144533843-144533865 TCCCTCAATCCCTGCATCTGTGG + Intergenic
942898137 2:181083054-181083076 TCCCACCACCCCTGGACCTGGGG + Intergenic
943687745 2:190836937-190836959 CCCAACCCTCTCTGCAGCTGTGG + Intergenic
947887190 2:233583067-233583089 TTCCAACAGAGCTGCAGCTGAGG - Intergenic
948768601 2:240236003-240236025 TCTTCCCATCACTGCAGCTGTGG - Intergenic
948863884 2:240765788-240765810 TCCCACCTTTCCTGTAGCTGTGG - Exonic
1170627948 20:18043758-18043780 TACCACCTTCGCTGCTGCTAAGG + Intronic
1171134043 20:22680682-22680704 TCCCACCAAAGCTCCAGCAGAGG + Intergenic
1172018740 20:31897625-31897647 TCCCACCCCCACTGCAGCAGTGG - Intronic
1173176725 20:40770674-40770696 TCCCACCACTGTTGCAGCTCAGG + Intergenic
1174143282 20:48432102-48432124 TCACACTGTCCCTGCAGCTGGGG + Intergenic
1174914433 20:54639971-54639993 GCCCACCATCTCTGCAGCTCTGG + Intronic
1175181095 20:57148240-57148262 TCTCACCATCTCTGCTGCAGTGG - Intergenic
1175545593 20:59775848-59775870 TGCCACCAGCGCTGAGGCTGAGG - Intronic
1175781974 20:61688597-61688619 TCGCAGCATCTCTGCAGCTCCGG + Intronic
1176308182 21:5135324-5135346 CCCTTCCCTCGCTGCAGCTGCGG + Intronic
1179653873 21:42833083-42833105 TGCCACCCTCACTGGAGCTGTGG + Intergenic
1179848878 21:44126708-44126730 CCCTTCCCTCGCTGCAGCTGCGG - Intronic
1181038715 22:20181995-20182017 GCCCACCAAGGCCGCAGCTGCGG - Intergenic
1182035708 22:27196703-27196725 CCCCACCCTCTCTGCAACTGAGG + Intergenic
1183658412 22:39204379-39204401 TCCCACCATCCCCGCAGCCATGG + Intergenic
1184296241 22:43527289-43527311 TCCCACCATTTCTACAGATGAGG + Intergenic
1184402543 22:44282269-44282291 TCCCACCCTGGCTGCTGCAGCGG - Intronic
1184786166 22:46673009-46673031 TCCCCCCATCCCCGCAGCTGGGG - Intronic
1184882302 22:47316240-47316262 TCCCACCATCGAGACAGCTCTGG + Intergenic
1185064980 22:48627693-48627715 TCACACCCTAGGTGCAGCTGAGG + Intronic
1185202342 22:49515573-49515595 TCCCTCCATGGCTGCTGATGAGG - Intronic
949851689 3:8426861-8426883 TCCAACCATCACAGCAACTGGGG - Intergenic
950242955 3:11388128-11388150 TCCCACCATGGCTGCCCCTATGG + Intronic
950517332 3:13475963-13475985 TCCCTTCATCTGTGCAGCTGAGG + Intergenic
950689110 3:14641631-14641653 TCCCACCATTTGTCCAGCTGAGG - Intergenic
951183077 3:19681937-19681959 TCCCAACAGACCTGCAGCTGAGG - Intergenic
951784514 3:26403250-26403272 TTCCAACAGCCCTGCAGCTGAGG - Intergenic
952026435 3:29088092-29088114 TCCCATCATTGTTGCAGCTGTGG - Intergenic
954035609 3:47849434-47849456 TTCCTCCATCCCTGCAGGTGAGG + Exonic
954519261 3:51208846-51208868 TCTCACCATGGCTGGCGCTGGGG - Exonic
955647785 3:61158914-61158936 TCCCACCTTTGTTGCAGCAGTGG - Intronic
956876298 3:73467091-73467113 CTGCACCATCTCTGCAGCTGGGG - Intronic
961217151 3:125168479-125168501 TTCCACCATCGCTGCACCAGTGG - Intronic
962334125 3:134510775-134510797 TCCCACCCTGGCTGCAGTTCTGG + Intronic
963252976 3:143119626-143119648 TCCCACCGTCGCTGCGCCTCGGG - Exonic
964203854 3:154148630-154148652 GCCCACAATCTCTGCAGGTGAGG - Intronic
966161741 3:176975800-176975822 CCCCACCATCTATTCAGCTGCGG - Intergenic
968643101 4:1724692-1724714 TCCCACCCTGGATGCAGATGAGG - Intronic
969074227 4:4564657-4564679 TCCCAGCCTCTCTGCAGCTAGGG - Intergenic
970870720 4:20814000-20814022 ACCCACTATCTGTGCAGCTGTGG + Intronic
973009386 4:45052456-45052478 TCCCAACAGACCTGCAGCTGAGG + Intergenic
973021018 4:45206746-45206768 TCCCTCCATCCCTTCAGATGGGG + Intergenic
975794246 4:77989410-77989432 TGCCACACTGGCTGCAGCTGGGG - Intergenic
978372884 4:108046851-108046873 TCTAACCTTCGGTGCAGCTGGGG - Intergenic
979024738 4:115554877-115554899 TCTCACCATCTCAGCTGCTGTGG + Intergenic
979982390 4:127272969-127272991 TCTCAACATGGCTGCAACTGGGG + Intergenic
980667336 4:135956585-135956607 TCTCAACATGGCTGCAACTGGGG + Intergenic
981715083 4:147744709-147744731 TCCCACAAAAGCTGCTGCTGTGG - Intronic
985152214 4:186959258-186959280 TTCCCCCATCCCTGCAGGTGGGG + Intergenic
985674491 5:1223945-1223967 TCCCCCCACCTCTGCTGCTGTGG - Exonic
986625599 5:9720933-9720955 TTCCAGCATTGCAGCAGCTGAGG - Intergenic
990314636 5:54572367-54572389 TCCCACCATCACTGGCTCTGAGG + Intergenic
992090389 5:73311533-73311555 TCCCAGCTCAGCTGCAGCTGAGG - Intergenic
992274588 5:75102159-75102181 TCCCAACAGACCTGCAGCTGAGG - Intronic
992277197 5:75131923-75131945 TCCCAACAGGCCTGCAGCTGAGG + Intronic
994601122 5:101906784-101906806 TGCTACCATAGCTGCAGCTATGG - Intergenic
995356240 5:111240884-111240906 TACCACCATCGTTGCCACTGGGG - Intronic
996291484 5:121857363-121857385 TCTCAACATGGCTGCAACTGAGG + Intergenic
997631368 5:135371545-135371567 TCCCACCATCTTTGGTGCTGTGG - Intronic
998523049 5:142817764-142817786 CTCCACCATCACTGCAGCAGGGG - Intronic
999867686 5:155719165-155719187 TTCCAACAGAGCTGCAGCTGAGG - Intergenic
1001971741 5:175961108-175961130 TCCCATCATGGCTGAAACTGAGG + Exonic
1002245702 5:177882673-177882695 TCCCATCATGGCTGAAACTGAGG - Intergenic
1002531465 5:179848904-179848926 GGCCAGCATCGCTGGAGCTGAGG + Intronic
1003134277 6:3421731-3421753 CCCCACCATCGCTACCACTGTGG - Intronic
1003920321 6:10826709-10826731 TCCCAGCCTCCCTGCAGCTAGGG + Intronic
1007481575 6:42153785-42153807 GCCCAGCATCTCTGCATCTGGGG - Intergenic
1007899960 6:45401808-45401830 TGCCACTAAGGCTGCAGCTGGGG - Intronic
1009250157 6:61288834-61288856 TCTCAACATGGCTGCAACTGGGG + Intergenic
1011139042 6:84133087-84133109 TCCCAACAGACCTGCAGCTGAGG - Intronic
1014863179 6:126496302-126496324 TCCCATCATCTCTGCCCCTGTGG + Intergenic
1015744055 6:136490799-136490821 TCCCATCATCACTGCTTCTGTGG + Intronic
1017097645 6:150818983-150819005 TCCCACCATCGCTGCAGCTGAGG + Intronic
1018853372 6:167657633-167657655 ACCCACCTTCCCTGCAGCTAAGG + Intergenic
1019447312 7:1078187-1078209 TCCCACCATAGCTGCATATCTGG - Intronic
1019515970 7:1440342-1440364 ACGCACCATGCCTGCAGCTGGGG - Intronic
1019599506 7:1874233-1874255 TCCCACCAGCGCATCAGCTTTGG + Intronic
1022477573 7:30721879-30721901 TCCCTCCATCTCTGCAGTTGGGG + Intronic
1023849192 7:44140820-44140842 TCCCACCTTCCCTAGAGCTGGGG - Intronic
1025102685 7:56149347-56149369 TCTCACCATGGCTGCAACTGAGG - Intergenic
1025829882 7:65039007-65039029 TCCCCCGATCGCTGCAGCCGAGG + Intergenic
1025917134 7:65874003-65874025 CCCCCCGATCGCTGCAGCCGAGG + Intronic
1027763292 7:82307055-82307077 TCAAACCTTGGCTGCAGCTGTGG - Intronic
1028077542 7:86534513-86534535 TCCCTCCACCATTGCAGCTGAGG - Intergenic
1030695986 7:112586133-112586155 TCCAAACATCGCTGCAGATCTGG - Intergenic
1031487047 7:122339768-122339790 TCCCAGCTACTCTGCAGCTGAGG + Intronic
1031706289 7:124984689-124984711 TCCCAACAGACCTGCAGCTGAGG - Intergenic
1031983062 7:128142086-128142108 TCCCACCCTGGCAGAAGCTGGGG + Intergenic
1033291023 7:140082864-140082886 GCCCACCATCGCTGATCCTGGGG - Intergenic
1034375635 7:150641600-150641622 TCCCACTTGCACTGCAGCTGAGG + Intergenic
1034669712 7:152848832-152848854 CCCCCCCGTAGCTGCAGCTGTGG + Intronic
1034830753 7:154305456-154305478 TCCCACCACCGGGGCAGGTGGGG - Exonic
1035600939 8:896385-896407 TCACACCATCCCGGCAGCTCAGG - Intergenic
1036125783 8:6061013-6061035 TCCCATCAAGGCTGAAGCTGGGG + Intergenic
1036699689 8:11004088-11004110 TCGCTCCATCTCTGCAGCTCAGG - Intronic
1036704780 8:11038991-11039013 GCCCACCCGCCCTGCAGCTGGGG - Intronic
1037579948 8:20239143-20239165 TCCCAGCCTTGCTACAGCTGTGG - Intergenic
1038353582 8:26805663-26805685 ACCCACCAGCTCTGGAGCTGGGG - Intronic
1040349678 8:46551595-46551617 GCCCACCATCACTACTGCTGTGG + Intergenic
1040368707 8:46746935-46746957 GCCCACCATCACTACTGCTGTGG - Intergenic
1040632291 8:49229642-49229664 TGCAACCATCACTGCAGTTGGGG - Intergenic
1040796269 8:51292747-51292769 TGCCACCATCACTGCAGTGGGGG + Intergenic
1040960526 8:53027358-53027380 TCCCAACATCAGTGCAGCAGGGG + Intergenic
1043526927 8:81107301-81107323 TCCCACCATTCCTTCACCTGGGG + Intronic
1045583460 8:103501762-103501784 TCCTACCATCACTGCAGTTTGGG + Intronic
1047563298 8:126012515-126012537 TCTCAACATGGCTGCAACTGGGG - Intergenic
1047677353 8:127217402-127217424 TCCTAACATCCCTGTAGCTGGGG + Intergenic
1047730426 8:127723477-127723499 TCTTACCCTCGCTGCAGCTCTGG - Intergenic
1048156574 8:131960976-131960998 TCCCAACAGACCTGCAGCTGAGG + Intronic
1048471387 8:134707197-134707219 TCCCACAATCCCTGGGGCTGGGG + Intronic
1049348101 8:142149464-142149486 CCACACCCTCGTTGCAGCTGAGG - Intergenic
1049639820 8:143710429-143710451 TCCCTGCATCCCTGCAGCAGGGG + Intronic
1049751919 8:144288956-144288978 TCCCTCCTTCACTGCACCTGGGG - Intronic
1053278146 9:36798679-36798701 TCCCACTAGGGCTGCAGCTGGGG - Intergenic
1056170484 9:83980277-83980299 TCGCACCATCGCTGAAGCCCTGG - Intronic
1057152288 9:92807188-92807210 TCCCACTCTCGCTGCAGCGGAGG - Intergenic
1060515396 9:124262620-124262642 GGCCACCACCGCTGTAGCTGTGG + Intronic
1062401000 9:136372593-136372615 TCCCACCAGCACAGCAGCTGGGG + Intronic
1186374717 X:8987482-8987504 TCCCACCAACCCTGCAGAAGAGG - Intergenic
1187769348 X:22677728-22677750 TCCCAACAGACCTGCAGCTGAGG + Intergenic
1189646276 X:43136069-43136091 ACCCACATTCCCTGCAGCTGGGG + Intergenic
1191051268 X:56194964-56194986 TGCCAACAGCCCTGCAGCTGAGG + Intergenic
1191833475 X:65439857-65439879 TCTCAACATGGCTGCAACTGGGG + Intronic
1193723954 X:85019132-85019154 TCCCAGCATCACCACAGCTGCGG - Intronic
1193729245 X:85082349-85082371 TTCCAACATACCTGCAGCTGAGG - Intronic
1194727003 X:97410293-97410315 CTCCACCAGAGCTGCAGCTGAGG + Intronic
1196799831 X:119532603-119532625 TCCCACCTACTCTGGAGCTGAGG - Intergenic
1196819649 X:119692777-119692799 CGCCTCCCTCGCTGCAGCTGCGG - Intronic
1198106048 X:133462212-133462234 CCCCACTAACACTGCAGCTGAGG - Intergenic
1200879199 Y:8194370-8194392 TGCCAACAGCCCTGCAGCTGAGG + Intergenic
1201700626 Y:16877794-16877816 TCTCAACATGGCTGCAACTGGGG - Intergenic
1202337583 Y:23827551-23827573 TCTCACCCTCCCTGCAGCAGAGG + Intergenic
1202533183 Y:25842520-25842542 TCTCACCCTCCCTGCAGCAGAGG - Intergenic