ID: 1017098966

View in Genome Browser
Species Human (GRCh38)
Location 6:150830907-150830929
Sequence GACAATCCTGTGACCAGAGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 125}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017098966_1017098974 27 Left 1017098966 6:150830907-150830929 CCAGCTCTGGTCACAGGATTGTC 0: 1
1: 0
2: 0
3: 13
4: 125
Right 1017098974 6:150830957-150830979 AACACATGCCCTCCTGAAATAGG 0: 1
1: 0
2: 0
3: 12
4: 142
1017098966_1017098971 -2 Left 1017098966 6:150830907-150830929 CCAGCTCTGGTCACAGGATTGTC 0: 1
1: 0
2: 0
3: 13
4: 125
Right 1017098971 6:150830928-150830950 TCAGGCGGGCCAGCAGTGCTGGG 0: 1
1: 3
2: 32
3: 92
4: 394
1017098966_1017098972 -1 Left 1017098966 6:150830907-150830929 CCAGCTCTGGTCACAGGATTGTC 0: 1
1: 0
2: 0
3: 13
4: 125
Right 1017098972 6:150830929-150830951 CAGGCGGGCCAGCAGTGCTGGGG 0: 3
1: 26
2: 88
3: 272
4: 779
1017098966_1017098970 -3 Left 1017098966 6:150830907-150830929 CCAGCTCTGGTCACAGGATTGTC 0: 1
1: 0
2: 0
3: 13
4: 125
Right 1017098970 6:150830927-150830949 GTCAGGCGGGCCAGCAGTGCTGG 0: 1
1: 0
2: 6
3: 39
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017098966 Original CRISPR GACAATCCTGTGACCAGAGC TGG (reversed) Exonic
903930549 1:26859494-26859516 GATATTCCTGTGACCTCAGCAGG - Intergenic
905517483 1:38572421-38572443 GACAATGCGGTGACAAGAGCAGG - Intergenic
911054414 1:93698066-93698088 GCCCTTCCTGTGAGCAGAGCTGG - Intronic
915846984 1:159276898-159276920 GATCATCCTGGGACAAGAGCAGG + Intergenic
916720042 1:167477929-167477951 GCCAATCCTGTGACCAGCCCTGG + Intronic
1065022672 10:21513694-21513716 GACCATCCTGTGTATAGAGCAGG - Exonic
1065780200 10:29160202-29160224 CACACTCCTGTTGCCAGAGCTGG + Intergenic
1066278877 10:33895707-33895729 GATTGTCCTGTGGCCAGAGCAGG - Intergenic
1070106453 10:73436723-73436745 GAAAATCCTGTTACTAGAGCTGG - Intronic
1072832746 10:98676259-98676281 GAGATACCTGTGAACAGAGCTGG + Intronic
1077114001 11:874934-874956 CACACTCCTGAGGCCAGAGCCGG - Intronic
1081734712 11:45394770-45394792 GACAATTCGGTGCCCAGGGCTGG + Intergenic
1081941056 11:46942376-46942398 GGCAAACCTGGGACCAGAACAGG - Intronic
1084557025 11:69881435-69881457 GGCCATCCTGGGACCAGTGCTGG + Intergenic
1084838380 11:71823807-71823829 GACAAACTTTTCACCAGAGCAGG + Intergenic
1085094282 11:73746653-73746675 GGCAATCCTCTCACCATAGCTGG - Intronic
1086869988 11:92026222-92026244 GAGCATCCAGTGACCAAAGCTGG + Intergenic
1091334183 11:134754247-134754269 GACAGTTCTGTCATCAGAGCTGG + Intergenic
1092106049 12:5922417-5922439 GACCCTCCTCTGACCAGAACAGG + Intronic
1092400320 12:8170287-8170309 GACAAACTTTTCACCAGAGCAGG - Intronic
1093142513 12:15525679-15525701 TACAATCCACTGATCAGAGCTGG + Intronic
1096950864 12:55469404-55469426 AACAATCATGTGAGAAGAGCAGG + Exonic
1099358894 12:81673114-81673136 GACAATTCTGGCACCAGGGCAGG + Intronic
1099968419 12:89475419-89475441 TATAATGCAGTGACCAGAGCAGG - Intronic
1101595227 12:106158767-106158789 GTCAAGCCTCTGACCAGATCTGG + Intergenic
1106525540 13:30538005-30538027 GACAGTCCCCTGCCCAGAGCAGG + Intronic
1114228210 14:20757721-20757743 GGCAATACTGTGACTGGAGCAGG + Intergenic
1118812482 14:69285380-69285402 GACAATCCTATTCCCACAGCAGG - Intronic
1119095137 14:71823129-71823151 AAGAATTCTGGGACCAGAGCAGG - Intergenic
1120693006 14:87614257-87614279 CACAATACTGTGTCCAGAGCAGG + Intergenic
1120827648 14:88969922-88969944 GAAAGTCCAGTGGCCAGAGCTGG - Intergenic
1122134699 14:99626173-99626195 GACATTCCTGTGACCCCAGCAGG + Intergenic
1122363515 14:101181306-101181328 GGCAATCCTATGACAAGGGCAGG - Intergenic
1126007841 15:44275329-44275351 GACACAGCTGTGAGCAGAGCTGG - Intergenic
1128671706 15:69578590-69578612 ACCAATCCTGTGAGCAGAGGAGG + Intergenic
1128738383 15:70066370-70066392 GACATTCATGTGAACTGAGCTGG - Intronic
1129069789 15:72941072-72941094 CACAACCCAATGACCAGAGCTGG - Intergenic
1129452697 15:75659682-75659704 GACAACACTGTTCCCAGAGCAGG - Exonic
1129466637 15:75727921-75727943 GGCAATCCTGAGCCCAGAGAGGG - Intergenic
1129473643 15:75768690-75768712 GAGAATGCAGTGAGCAGAGCGGG + Intergenic
1131904891 15:97132544-97132566 GACAATCCTCTGATCAGGGTAGG + Intergenic
1132112880 15:99115165-99115187 CACAATCCTGGGAACGGAGCAGG - Intronic
1132331795 15:101017073-101017095 GATATTTCTGTGAGCAGAGCTGG - Intronic
1135507583 16:23052269-23052291 GCCACTCCTGGGACCAGTGCAGG + Intergenic
1136192026 16:28622515-28622537 GAAAATCTTGTTACCAAAGCAGG + Intronic
1137496267 16:48971598-48971620 GACACTGCTGTGATCAGGGCTGG - Intergenic
1138264991 16:55654164-55654186 GACAATCCTGTAAGGAAAGCAGG - Intergenic
1138618486 16:58192095-58192117 AACAATCCTGTGACTTAAGCAGG + Intronic
1142102484 16:88282747-88282769 GTCATCCCTGTTACCAGAGCAGG + Intergenic
1143376916 17:6472415-6472437 CACACTCCTGTGGCCAGGGCTGG - Intronic
1144704251 17:17356856-17356878 GACAAACCTGGGACCAGGGCTGG - Intergenic
1148454879 17:47805848-47805870 GACACTCATCGGACCAGAGCAGG + Intergenic
1152912594 17:83013627-83013649 GACCAGGATGTGACCAGAGCCGG + Intronic
1154485264 18:14867499-14867521 GGCAATCCTCTGACCACCGCAGG + Intergenic
1155485815 18:26341228-26341250 GACAATCTTATAAGCAGAGCAGG - Intronic
1155605471 18:27600793-27600815 GACATTTGTGTGACCAGACCTGG + Intergenic
1162922381 19:13911062-13911084 TAAAATTTTGTGACCAGAGCTGG + Intronic
1166355753 19:42226266-42226288 GACTATCATGTGCACAGAGCTGG + Exonic
927274948 2:21254762-21254784 GTCAAGCCTGTGTCCAGAGGAGG - Intergenic
929342913 2:40844597-40844619 GAAAATTCTGTAACCAGGGCTGG + Intergenic
929922809 2:46184632-46184654 GACCAGCCTGTCACCAAAGCAGG - Intronic
934662479 2:96150479-96150501 GGCTCCCCTGTGACCAGAGCTGG + Intergenic
934791245 2:97062705-97062727 GACATTCCTATAGCCAGAGCAGG - Intergenic
934815197 2:97319821-97319843 GACATTCCTATAGCCAGAGCAGG + Intergenic
934822498 2:97388662-97388684 GACATTCCTATAGCCAGAGCAGG - Intergenic
942420857 2:175806068-175806090 GACAACCCTGAGGTCAGAGCTGG - Intergenic
945273257 2:207962770-207962792 GACAGTGCAGTGCCCAGAGCAGG + Intronic
946232273 2:218299049-218299071 GACAATTCTGTGACCATATCAGG + Intronic
946808906 2:223501367-223501389 GACACCTCAGTGACCAGAGCTGG - Intergenic
946876621 2:224136080-224136102 GACAGTCCTGTGATAAGTGCTGG + Intergenic
947686411 2:232089677-232089699 GCCAAGCCTATCACCAGAGCTGG - Intronic
948237461 2:236401370-236401392 GACAATCCTGTCAAAAGGGCAGG - Intronic
1174480541 20:50828260-50828282 GGCAGTGCTGTGACCAGAGGAGG + Intronic
1174560818 20:51429410-51429432 CACATTCCTGAGGCCAGAGCTGG - Intronic
1175728623 20:61336575-61336597 GCCAAGCCTGTGTGCAGAGCAGG + Intronic
1175751462 20:61500993-61501015 GTCATTCCTGTGTCCACAGCAGG + Intronic
1176723902 21:10414407-10414429 GGCAATCCTCTGACCACCGCAGG + Intergenic
1178921094 21:36738717-36738739 GGCAATCCTGTGAAATGAGCTGG + Intronic
1180305150 22:11067581-11067603 GGCAATCCTCTGACCACCGCAGG + Intergenic
1183060990 22:35336313-35336335 GCCAGTCAGGTGACCAGAGCTGG - Intronic
1184316189 22:43691845-43691867 GAAAGTACTGTGACCAGAGCAGG + Intronic
950688794 3:14639160-14639182 GACAATCCTCGGACCTTAGCTGG - Intergenic
952743346 3:36755990-36756012 TACAGTCCAGTGGCCAGAGCTGG + Intergenic
954456444 3:50602260-50602282 GCCCTTCCTGTCACCAGAGCTGG - Intergenic
954735004 3:52699991-52700013 GACACTCTAGTGACTAGAGCAGG + Intronic
956379844 3:68654023-68654045 GCCAGTGCTGTGGCCAGAGCTGG - Intergenic
957320750 3:78627361-78627383 GACAATCCTGTAACATGGGCTGG + Exonic
960963988 3:123091953-123091975 GACAATCCTATAACTAAAGCAGG - Intronic
961534216 3:127559649-127559671 GCCAATGCTCTGACCAGGGCTGG - Intergenic
965472619 3:169114208-169114230 GGCAGTCCTGTTACCAGAGAAGG - Intronic
971300124 4:25435045-25435067 GAGAATCTTGTGACTATAGCTGG - Intergenic
973840494 4:54855739-54855761 GACAATCCCGCGGCCAGACCCGG + Intergenic
975347492 4:73309920-73309942 GACAAGCCTCAGACCAGATCTGG + Intergenic
983705818 4:170658037-170658059 GACAATACTGAGAACAGAGCTGG + Intergenic
985963973 5:3325485-3325507 GACAGTGCTGTGACCAGCGGGGG + Intergenic
989552009 5:42746285-42746307 CCAAACCCTGTGACCAGAGCTGG - Intergenic
991944721 5:71888968-71888990 GACAACCCTGGGAGAAGAGCAGG - Intergenic
993252624 5:85548665-85548687 GGCACTCCTGTGACCACTGCTGG - Intergenic
997825393 5:137102196-137102218 GAGGTTCATGTGACCAGAGCAGG + Intronic
1001952660 5:175827018-175827040 AACCACCCTGTGACGAGAGCTGG - Intronic
1004286207 6:14322967-14322989 GACAATCCTGTGAATGGAGGAGG + Intergenic
1004354232 6:14917139-14917161 GACAATAGTGTGTCCAGAGTCGG - Intergenic
1005234823 6:23747711-23747733 GTCAATCCTTTCACCAGAGAAGG + Intergenic
1005976596 6:30804846-30804868 GCCAAACCTGTGACCAGTGTGGG - Intergenic
1007290089 6:40779080-40779102 GAAACTCTTGTGGCCAGAGCAGG - Intergenic
1008602209 6:53107310-53107332 CCCAATCCTGTGCCCAGAGCAGG - Intergenic
1014423358 6:121271806-121271828 GACAATCCTAAGACAAAAGCTGG + Intronic
1015066378 6:129034043-129034065 GAAAATGATGTGACCAGAGAAGG + Intronic
1016225491 6:141730027-141730049 GCAAATGCTGTAACCAGAGCTGG + Intergenic
1017098966 6:150830907-150830929 GACAATCCTGTGACCAGAGCTGG - Exonic
1017893139 6:158655869-158655891 GACAGTCATGAGACCAGGGCTGG - Intronic
1018685645 6:166302332-166302354 TGCCATCCTGTCACCAGAGCGGG - Intergenic
1018765405 6:166929044-166929066 GACACACCTGTGACCACACCAGG + Intronic
1019720423 7:2567254-2567276 CACAATACTGTGTCGAGAGCTGG + Intronic
1022526693 7:31042670-31042692 GATCAGTCTGTGACCAGAGCAGG + Intergenic
1023990510 7:45125731-45125753 GCCCATCCTGTGTGCAGAGCAGG - Intergenic
1024732771 7:52271830-52271852 CACAATCCTCTGACCAGAACTGG + Intergenic
1025976662 7:66376334-66376356 GACAATCCTGAGACAGGGGCTGG + Intronic
1030912639 7:115270927-115270949 GACACCCCACTGACCAGAGCTGG - Intergenic
1034159847 7:148985420-148985442 GACAGTCCTGTGTTCATAGCTGG + Intergenic
1034886840 7:154804754-154804776 GCTACACCTGTGACCAGAGCAGG - Intronic
1035822899 8:2614076-2614098 GACAGTCATATGGCCAGAGCAGG - Intergenic
1036077623 8:5519375-5519397 GACAAGACAGTGACCAGAGATGG - Intergenic
1045799304 8:106083317-106083339 AAGAATCCTGAGCCCAGAGCAGG + Intergenic
1047995925 8:130335786-130335808 GAAAATCCTGTGAACACAACAGG + Intronic
1048443581 8:134477413-134477435 CACAATGCTGTGCACAGAGCAGG + Intergenic
1049019865 8:139948665-139948687 CCCAATCCTGTGGCCAGATCAGG - Intronic
1050521755 9:6508274-6508296 GGCAGTCTTGTGTCCAGAGCTGG + Intergenic
1051390090 9:16554718-16554740 CAGAATCCAGTGACCAGATCGGG + Intronic
1060156982 9:121326817-121326839 GACAACCCTGTGGCCACGGCAGG - Intronic
1061012191 9:127962266-127962288 GACACTCCAGTGGCCAGAGGTGG - Intronic
1061852434 9:133424010-133424032 GAAACACCTGTGCCCAGAGCAGG + Intronic
1189120778 X:38392485-38392507 GACAACCCTGTAACTAGAGCTGG - Intronic
1189522720 X:41786618-41786640 CACAATCATCCGACCAGAGCTGG + Intronic
1194854709 X:98915002-98915024 AACAATCCAGGGACCAGAGTGGG - Intergenic
1198168064 X:134077260-134077282 GACCATTTTGTGACCAGAGAGGG - Intergenic
1198226921 X:134653668-134653690 AACAATCCTGAGACAAGAGCAGG - Intronic
1200149880 X:153946169-153946191 GACAGGCCTGTGAGCAGGGCAGG - Intergenic
1201905544 Y:19082757-19082779 GACAATCCTTTGACCTGACATGG + Intergenic