ID: 1017099162

View in Genome Browser
Species Human (GRCh38)
Location 6:150832221-150832243
Sequence CTTACTTTGGAGAAGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 581
Summary {0: 1, 1: 0, 2: 4, 3: 56, 4: 520}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017099162_1017099169 18 Left 1017099162 6:150832221-150832243 CCTTCTTCCTTCTCCAAAGTAAG 0: 1
1: 0
2: 4
3: 56
4: 520
Right 1017099169 6:150832262-150832284 GATTTCAGATGTCCTTAAAACGG 0: 1
1: 0
2: 2
3: 31
4: 262

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017099162 Original CRISPR CTTACTTTGGAGAAGGAAGA AGG (reversed) Intronic
900411327 1:2513997-2514019 CTTACTTTGGAGTAGGGATCCGG + Exonic
900961234 1:5922133-5922155 CTGCCTTTGAAGATGGAAGAAGG + Intronic
901253104 1:7796663-7796685 GATACTTTGGAGGGGGAAGAAGG + Intronic
901714012 1:11138653-11138675 CTTCCTTTTAAGAAGGAGGAAGG + Intronic
902652979 1:17848704-17848726 TTTGCTCTGGAGAAGGAAGCAGG - Intergenic
902968804 1:20031799-20031821 CTTAGATTGGAGAAGGGAGGAGG + Intronic
903688746 1:25153931-25153953 CTGGCTTTGAAGATGGAAGAGGG - Intergenic
904096024 1:27978069-27978091 CTGTCTTTGAAGATGGAAGATGG + Intronic
904827641 1:33284642-33284664 GTTAGTTGGAAGAAGGAAGAAGG + Intronic
905110762 1:35592809-35592831 CTCACATTGTAGAAGGGAGAAGG + Intronic
905413662 1:37790083-37790105 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
905737965 1:40343767-40343789 CTAACTTTGAAGATGGAGGAAGG - Intergenic
905998448 1:42402472-42402494 CTGGCTTTGGACATGGAAGAGGG + Intronic
906809212 1:48809117-48809139 CCTACTTTAGGGAAGGAGGAGGG + Intronic
906855401 1:49298644-49298666 CTTATTTTCAAGAAGGAGGAGGG - Intronic
907393557 1:54174400-54174422 CCTACTATGTAGAAGGAGGATGG - Exonic
907548661 1:55285531-55285553 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
908063616 1:60378527-60378549 ATTACTTTGGAGAAGATAAAGGG + Intergenic
908888146 1:68813693-68813715 CTGACTTTGAAGAAGGAGGAAGG + Intergenic
909158394 1:72112160-72112182 CTTACGTTGGAGAATGAAAATGG - Intronic
909783229 1:79575631-79575653 CTCACTGTGGAGTAGGAAAAGGG - Intergenic
909852133 1:80480970-80480992 CTCACTTTTTAGAAGGAAAAGGG + Intergenic
910040039 1:82839305-82839327 CTTACTTTGGACAAGGACAGAGG + Intergenic
910212034 1:84803463-84803485 TTTATTTTGGAGATGTAAGAGGG - Intergenic
910680607 1:89860400-89860422 CTTACTAAGGAGAAAGATGAAGG - Intronic
910793021 1:91070579-91070601 CTGAGTTTGTAGCAGGAAGAGGG + Intergenic
911205533 1:95088545-95088567 CTTACTTTGTTAAAGGAAGATGG + Intergenic
911259346 1:95667733-95667755 CTCACTTGGCAGAAGGTAGAAGG + Intergenic
911525309 1:98977426-98977448 ATTGCTTTGGGGCAGGAAGATGG - Intronic
912197769 1:107419609-107419631 TTTTTTTTGAAGAAGGAAGAAGG - Intronic
912941446 1:114048728-114048750 CTTACATGGAAGAAGGCAGACGG + Intergenic
913007206 1:114646342-114646364 TTTTCTTTGGAAAAGGAAAATGG + Intronic
913382213 1:118224704-118224726 CTTTTTTTGGAGGAGGAAGTTGG + Intergenic
914220376 1:145676153-145676175 CTTACTTTGGAGAGCGGGGAAGG + Intronic
914384157 1:147151381-147151403 CTTACATGGTAGAAGGCAGAGGG + Intergenic
914472954 1:147999025-147999047 CTTACTTTGGAGAGCGGGGAAGG + Intergenic
914810674 1:151025496-151025518 GTTCCTGTGGAGAAGGGAGATGG - Exonic
914925386 1:151881682-151881704 CTTGCTTTTTAGAAGCAAGAGGG - Intronic
915225457 1:154407882-154407904 CTTGCATTGCAGTAGGAAGAGGG - Intronic
915239165 1:154507587-154507609 ATCACTTTGGAGATGGTAGAGGG - Intronic
915252209 1:154598631-154598653 GTCTCTTTGGAGAAGGCAGAAGG - Intronic
915433298 1:155883709-155883731 CTTGCTTTGGCGAAGGGAGTCGG + Exonic
915960769 1:160264645-160264667 CTTAGTTTGGAGAAACAAGATGG + Intergenic
917629411 1:176878061-176878083 GATAATTTGGAGAAGGTAGAGGG - Intronic
917884677 1:179371771-179371793 CTGGCTTTGAAGAAGGAGGAAGG + Intronic
918405116 1:184204478-184204500 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
918978316 1:191520690-191520712 CTTTCTCTCTAGAAGGAAGAAGG - Intergenic
919500863 1:198336768-198336790 CTGGCTTTGAAGATGGAAGAAGG - Intergenic
919834569 1:201564864-201564886 CTGACTTTGAAGATGGAAAAAGG - Intergenic
920744054 1:208608804-208608826 CTTACATGGCTGAAGGAAGAAGG + Intergenic
920852792 1:209640005-209640027 CCAGCTTTGGAGAGGGAAGATGG - Intronic
921082513 1:211754139-211754161 CTTACTCTGGAGAGGGAAATAGG - Intronic
922386339 1:225087616-225087638 CAGACCTTGGAGAAGGAAGATGG + Intronic
922966406 1:229694537-229694559 CTTAATTTGCAGCAGGAAGCGGG + Intergenic
923641072 1:235761502-235761524 CTTACTATGGAAATAGAAGAGGG + Intronic
924428348 1:243974429-243974451 CTCGCTTTGGAGAGGGAAGGAGG + Intergenic
1062997609 10:1881687-1881709 GTTTCTGTGGAAAAGGAAGAGGG + Intergenic
1063194021 10:3723194-3723216 CTCACTTTGGGGCAGAAAGAGGG + Intergenic
1063218969 10:3948845-3948867 CTTACCCTGGAGGAGGAAGTAGG + Intergenic
1063390247 10:5645644-5645666 GTTACTGTGGAGAGGGGAGAGGG - Intronic
1065432383 10:25672862-25672884 CTGACTTTGTAGTAGTAAGAGGG - Intergenic
1065927737 10:30450643-30450665 ATGTCTCTGGAGAAGGAAGACGG - Intronic
1066055878 10:31679444-31679466 CTTTCTTTGGGGAAGAAAGATGG - Intergenic
1067266305 10:44748374-44748396 CTCACTTTGGGGAAGAGAGATGG - Intergenic
1067985567 10:51140030-51140052 TCTAGTTTGGAGAAGGAAGCTGG - Intronic
1068105955 10:52616622-52616644 CTGGCTTTGAAGATGGAAGAGGG - Intergenic
1068124499 10:52822347-52822369 CTGAGTTCAGAGAAGGAAGATGG + Intergenic
1068544529 10:58330992-58331014 CTTTCCTTGAAGAAGGAATAAGG + Intergenic
1068988698 10:63130067-63130089 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
1069080082 10:64079336-64079358 CTTAATCTTGAGAAGTAAGAGGG + Intergenic
1069086573 10:64146843-64146865 CTGACTTTGCAGATGGAGGAAGG + Intergenic
1070148964 10:73793800-73793822 CTTACCTTGGTGGAGGTAGAAGG - Intronic
1070369242 10:75766168-75766190 CTTACTTTGTAAAAGTAAGTTGG - Intronic
1070629453 10:78074568-78074590 CTGGCTTTGAAGATGGAAGAGGG + Intergenic
1071318046 10:84422132-84422154 CTCACTTTGCAGAAGGAAGAAGG + Intronic
1071805616 10:89117279-89117301 CTGACTTTGAAGATGGAAGAAGG + Intergenic
1073728783 10:106267302-106267324 ATGGCTTTGGAGAAGGAAGATGG + Intergenic
1075303062 10:121342499-121342521 CATAATTTTGAGATGGAAGAGGG + Intergenic
1075411105 10:122228526-122228548 CTTACTTTGGGGAATGCACAAGG - Intronic
1075866451 10:125725108-125725130 CTGGCTTAGGAGGAGGAAGACGG + Intronic
1075957239 10:126534621-126534643 CTTCCTTTGGAAGTGGAAGAAGG - Intronic
1076267832 10:129122911-129122933 CTGACTTTGGAGGAGCAAGTTGG - Intergenic
1077781447 11:5334295-5334317 CCTCCTTTGGAGAAGGAAGTGGG + Intronic
1077865722 11:6219660-6219682 TTTATTTTAGAAAAGGAAGAAGG + Intronic
1078248817 11:9600559-9600581 TGTACAATGGAGAAGGAAGAAGG - Intergenic
1079326893 11:19501078-19501100 CTGACTTTGAAGATGGAAGGAGG - Intronic
1079481118 11:20881120-20881142 CTTACTTATCAGAAGGAAAAGGG - Intronic
1080228397 11:29987009-29987031 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
1080586027 11:33683354-33683376 CTTTTTTTTTAGAAGGAAGATGG - Intergenic
1080963723 11:37190002-37190024 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
1081915786 11:46729361-46729383 CAAGCTTTGGGGAAGGAAGAAGG - Exonic
1082766789 11:57175172-57175194 CTAGCTTTGGAGATGGAGGAAGG - Intergenic
1082912970 11:58397443-58397465 CCTATTTTGGGGAAGAAAGAGGG + Intergenic
1083084838 11:60131997-60132019 ATAACTTTTGAGGAGGAAGAGGG + Intergenic
1083970665 11:66072001-66072023 TTACCTTTGTAGAAGGAAGAGGG - Intronic
1083991695 11:66250081-66250103 CTTACTCTGGGGTTGGAAGAGGG - Intergenic
1084463241 11:69307838-69307860 CTGAGCTGGGAGAAGGAAGATGG - Intronic
1084563486 11:69916999-69917021 CTGACTTTGAAGATGGAGGAAGG - Intergenic
1084702369 11:70795796-70795818 CTGGCTTTGGAGACGGAGGAAGG + Intronic
1085058502 11:73423188-73423210 ACAACTTTGGAGATGGAAGAGGG - Intronic
1085347826 11:75779616-75779638 CTACCTTTGGGGAAGGCAGAGGG - Intronic
1086229200 11:84548190-84548212 CTGGCAGTGGAGAAGGAAGAAGG - Intronic
1086662378 11:89435885-89435907 TTTACTTTTGAGAAATAAGAAGG - Intronic
1087262269 11:96024238-96024260 CTGAGTTTGGAGAAAGAACATGG + Intronic
1089147959 11:116344131-116344153 CTTACTCTGAAGATGGAGGAAGG - Intergenic
1089566736 11:119375745-119375767 CTTACTGTGGGGGAGGGAGAGGG - Intronic
1089820357 11:121220234-121220256 CTGACTTTGAAGATGGAGGAAGG + Intergenic
1089900117 11:121973232-121973254 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
1090570400 11:128038598-128038620 CTGACTTGGAAGAAGGAGGAGGG - Intergenic
1091756083 12:3052716-3052738 CTCACTTGGCAGAAGGCAGAAGG - Intergenic
1091828245 12:3531286-3531308 CTTGCCTTGGGGAGGGAAGAGGG + Intronic
1091864345 12:3818279-3818301 GTTTCTTTTGTGAAGGAAGAAGG - Intronic
1091868770 12:3869041-3869063 CTGACTTTGGAGATGAAGGAAGG - Intronic
1092262908 12:6962063-6962085 CTGACATGGGGGAAGGAAGAGGG - Intergenic
1092322031 12:7486620-7486642 CTCATTTTGGGGAAGGAACAGGG - Exonic
1092901377 12:13062676-13062698 CTTACTGAGGAGGAGGAAGCAGG - Intronic
1093105885 12:15086583-15086605 CTGACTTTGAAGAAGGAGGAAGG - Intergenic
1093786619 12:23199217-23199239 ATGACTTTGAAGAGGGAAGAAGG + Intergenic
1093810244 12:23483983-23484005 GTTACTTGTGAAAAGGAAGAAGG + Intergenic
1093979276 12:25457250-25457272 ATTACTCTGGGGAAGGGAGAAGG - Intronic
1095837398 12:46653865-46653887 ATCACTTTGCAGCAGGAAGAAGG + Intergenic
1096135747 12:49198968-49198990 TCTGCTTTGGAGAAGGAAGGGGG - Intronic
1096298926 12:50408690-50408712 AATACTTTTGAGAAGGAAAAAGG - Intronic
1096418082 12:51431114-51431136 CTGGCTTTGGAGATGGAGGAAGG - Intronic
1096750572 12:53756302-53756324 CTTACTTTGGGGAGGTAAGAGGG - Intergenic
1096754747 12:53789843-53789865 TTGACTCTGGAGAAGGAAGGGGG + Intergenic
1097543468 12:60969572-60969594 CTTGCTTTGGAGGACAAAGAAGG + Intergenic
1097589536 12:61557284-61557306 CTGGCTTTGGAGATGGATGAAGG + Intergenic
1098128703 12:67325659-67325681 CTAACTTTGGAAGATGAAGAAGG - Intergenic
1098576764 12:72051537-72051559 CTTGCTTTGAAGATGGAAAAAGG - Intronic
1098685376 12:73412905-73412927 CTTGCTTTGGAGATGGAGGAAGG + Intergenic
1099015268 12:77336714-77336736 CTGACTTTGAAAATGGAAGAAGG + Intergenic
1099030474 12:77520145-77520167 CTGGCTTTGAAGATGGAAGAAGG - Intergenic
1099079347 12:78157075-78157097 TTATCTTTGGGGAAGGAAGAGGG + Intronic
1099644969 12:85341436-85341458 CTGCCTTTGAAGAAGGAGGAAGG - Intergenic
1100300745 12:93305323-93305345 TGTACTTTGCAGAAGGAATAGGG - Intergenic
1101197911 12:102404510-102404532 CTGACTGAGTAGAAGGAAGATGG + Intronic
1102560138 12:113756076-113756098 CTGACCTTGAAGAAGGAAGAAGG + Intergenic
1102949383 12:117019821-117019843 ATTACCTTGGAGAAGAAAGAGGG - Intronic
1103962554 12:124618001-124618023 CCTGCGGTGGAGAAGGAAGAGGG + Intergenic
1104711478 12:130989875-130989897 CTTTCTGTAGAGGAGGAAGAAGG + Intronic
1105321997 13:19334838-19334860 ATTACTTTTGCAAAGGAAGAGGG - Intergenic
1106387599 13:29302727-29302749 CTGACTTTGGAGAAGACAGGCGG + Intronic
1106873280 13:34044619-34044641 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
1107526590 13:41238570-41238592 TTTACTTTGGAGTTGCAAGATGG - Intronic
1107945305 13:45412718-45412740 CTTATTATGGAAAAGGAAGATGG - Intronic
1109973433 13:69800139-69800161 CTGACTTTGGGGATAGAAGATGG - Intronic
1111192416 13:84826693-84826715 TGTACTTGGGAAAAGGAAGAAGG - Intergenic
1111204699 13:84990462-84990484 CTTACTGGTGAGAAGCAAGACGG + Intergenic
1111258967 13:85710218-85710240 CTCACTTGGGAGAAGGCAGAGGG + Intergenic
1112884032 13:104147014-104147036 CTCACATGGTAGAAGGAAGAAGG + Intergenic
1113043436 13:106128526-106128548 CTGGCTTTGGAGATGGAGGAAGG - Intergenic
1113205854 13:107915125-107915147 CTTCCATTTGAGAAGAAAGAAGG - Intergenic
1114171475 14:20277142-20277164 CTCACTTGGCAGAAGGCAGAAGG + Intronic
1114544684 14:23490189-23490211 ATAATTTTGGAGTAGGAAGATGG - Intronic
1115082268 14:29469409-29469431 CTTACTTTGGTGAAGGAATAGGG - Intergenic
1115766160 14:36625540-36625562 CTCTGTTTGGAGAAGGAAGCCGG - Intergenic
1117909369 14:60622025-60622047 TTTACATTGTAGCAGGAAGAAGG - Intergenic
1118171579 14:63394537-63394559 CATTATTTGGAGAAGGAAAAGGG - Intronic
1118915709 14:70101836-70101858 CCTATTGTGGAGCAGGAAGATGG + Intronic
1119076477 14:71645117-71645139 CTGGCTTTGGAGATGGAGGAAGG - Intronic
1120645003 14:87063604-87063626 TTTACTTTGGAAATGGAAGTGGG + Intergenic
1121571228 14:94947970-94947992 CTGGCTTTGAAGAAGGAGGATGG + Intergenic
1121577275 14:94998420-94998442 CTTGATTTGGAGAAGGAAGTAGG + Intergenic
1121926837 14:97934712-97934734 CTGACTTTGAAGAAAGAGGAAGG + Intronic
1122488777 14:102099008-102099030 CTAACTTTGGAGAAGGTACAGGG - Intronic
1122754400 14:103966686-103966708 CTAAAATTGGAGAAGGAAAAAGG - Intronic
1125278022 15:38013963-38013985 CTAGCTTTGGAGATGAAAGAAGG - Intergenic
1126466985 15:48969785-48969807 CTGCCTTTGGAGATGGAGGAAGG + Intergenic
1126925531 15:53581555-53581577 TTTACATAGGAGATGGAAGATGG + Intronic
1127124876 15:55802185-55802207 GTTATTTTGGAGAAGAGAGAAGG + Intergenic
1127246371 15:57179796-57179818 ATTAATTTGGGGGAGGAAGAAGG - Intronic
1127612939 15:60654784-60654806 CTGACTTTGGAGACAGAGGAAGG + Intronic
1128215464 15:65931252-65931274 CTGACTTTGAAGATGGAGGAAGG + Intronic
1128317148 15:66668139-66668161 CTGACTTTGAAGATGGAGGAAGG + Intronic
1130161095 15:81401113-81401135 CTGGCTTTGAAGAAGGAGGAAGG - Intergenic
1130763492 15:86845953-86845975 CTTTCTTTCAAGAGGGAAGAAGG - Intronic
1130893841 15:88155296-88155318 CTGGCTTTGAAGATGGAAGAGGG + Intronic
1131718700 15:95143048-95143070 CTTATTTGGGGGAAGGCAGAAGG + Intergenic
1133456591 16:5947657-5947679 TTTACAATAGAGAAGGAAGATGG - Intergenic
1133469724 16:6063194-6063216 ATCACTTTGGAGCAGCAAGAGGG + Intronic
1133472612 16:6090110-6090132 CTGGCTTTGAAGATGGAAGAAGG - Intronic
1133605190 16:7379966-7379988 CTAACTTTGGAGAAGGAGGCAGG - Intronic
1133815411 16:9193798-9193820 CTGGCTTTGGAGAGGGAGGAAGG - Intergenic
1133904068 16:10004641-10004663 CTTGCTTTGAAGATGGAGGAAGG - Intronic
1135132797 16:19866771-19866793 TTTGCTTTGGAAAAGAAAGAGGG + Intronic
1135353105 16:21746580-21746602 CTGATTTTGGAGATGGAGGATGG + Intronic
1135451592 16:22562703-22562725 CTGATTTTGGAGATGGAGGATGG + Intergenic
1135930095 16:26728984-26729006 CTTAATTTTGAGAAGTAAGGTGG + Intergenic
1137067449 16:35863235-35863257 CTTGTTTTGGAGATGGCAGAAGG - Intergenic
1137384233 16:48026801-48026823 CTTACATGGCAGAAGGCAGAAGG + Intergenic
1137827305 16:51510164-51510186 CTGACAAAGGAGAAGGAAGATGG - Intergenic
1137852032 16:51755369-51755391 ATTACCTTGGAGAAAGAAGCCGG - Intergenic
1138128561 16:54458571-54458593 CCTACTTTGGTGAAAGAAAATGG - Intergenic
1139015122 16:62680497-62680519 CTTTATATGGAGCAGGAAGAGGG + Intergenic
1139839882 16:69869801-69869823 CTTACTTTAGAGAAGGTAGCTGG + Intronic
1140706969 16:77639851-77639873 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
1141304366 16:82847427-82847449 CTGACTTTGAAGATGGAGGAAGG - Intronic
1143114775 17:4576325-4576347 CCTGCTTTGGAGGAGGAAGATGG + Intergenic
1145111867 17:20170748-20170770 CTTAATTTGGAACAGGAAGTTGG - Intronic
1146138366 17:30343110-30343132 CAAACTTAGGGGAAGGAAGAGGG - Intergenic
1146398158 17:32484960-32484982 CTTTCCTTTGAGAAGGAAAAGGG + Intergenic
1146505737 17:33403331-33403353 CTGACTGAGGAGAAGGCAGAAGG - Intronic
1146537831 17:33668439-33668461 CTGACTTTGAAGATGGAGGAAGG - Intronic
1147040460 17:37714360-37714382 CTTGCATTGGTGAAGGAAGAAGG - Intronic
1147145668 17:38483067-38483089 CTTTCTCTGTAGAAGGCAGAGGG + Intronic
1148391207 17:47274524-47274546 CTTAGTCTGGAGAAGAAACAAGG - Intronic
1148756408 17:49975376-49975398 CTCACCTTGGGGAAGGAGGAGGG + Intergenic
1150222325 17:63503188-63503210 TTTGCGTAGGAGAAGGAAGAGGG - Intronic
1150968909 17:70004362-70004384 CTGACTTTGAATATGGAAGAGGG - Intergenic
1151707022 17:75774506-75774528 CTTACCTTGGAGGAGGATGCTGG + Intergenic
1153164208 18:2243570-2243592 CTGGCTTTGAAGATGGAAGAGGG - Intergenic
1153339230 18:3957225-3957247 CTGAGTTTGGAGATGGAAGAAGG + Intronic
1153852297 18:9106849-9106871 CTGGCTTTGGAGATGAAAGAAGG - Intronic
1154477621 18:14779054-14779076 ATTATTTTGGCTAAGGAAGAGGG + Intronic
1154482180 18:14841656-14841678 ATTATTTTGGCTAAGGAAGAGGG + Intronic
1155344795 18:24847651-24847673 CTGGCTTTGGAGTTGGAAGAAGG + Intergenic
1155423461 18:25680930-25680952 CTTCCTGTAGAGGAGGAAGAGGG - Intergenic
1155628456 18:27863318-27863340 CTTACTTTCTGGAAGGTAGAAGG + Intergenic
1155753660 18:29462145-29462167 CGTCTTTTTGAGAAGGAAGATGG - Intergenic
1156161891 18:34369605-34369627 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
1156210710 18:34938542-34938564 CTTATGTTGGAAAAGGAAGTGGG + Intergenic
1158621686 18:59038123-59038145 CTTATTAAGGAGAAGAAAGAAGG + Intergenic
1158990863 18:62867059-62867081 GTTACTTTGATGAAGGAAAAAGG - Intronic
1159189648 18:65025200-65025222 CATAGTTAGGAGAAGGGAGAAGG - Intergenic
1159966083 18:74597602-74597624 CTTCCCTTAGAGAAGGAAAACGG - Intergenic
1160271272 18:77386542-77386564 CTGGCTTTGGAGATAGAAGAAGG + Intergenic
1160303439 18:77707048-77707070 CTTACTATGCTGAAGGATGAAGG - Intergenic
1160396038 18:78572836-78572858 CTGACTTTGGAGGTGGAAGAGGG + Intergenic
1161806368 19:6445489-6445511 CTGGCTTTGAAGATGGAAGAAGG + Intronic
1161998094 19:7726794-7726816 CTGCCTTTGAAGATGGAAGAAGG + Intergenic
1162588654 19:11576965-11576987 CTTCCTTTGGTGAGGGCAGAGGG - Intronic
1163541801 19:17915900-17915922 CTTTCTCTGGAGAGGGAAGAGGG - Intergenic
1164956852 19:32393588-32393610 CTTCCTTGGGAGAAGGAATTTGG - Intergenic
1167582749 19:50356055-50356077 CTGGCTTTGAAGAAGGGAGAAGG - Intronic
1168383382 19:55942992-55943014 CTGCCTTTGAAGAAGGAGGAAGG + Intergenic
925024063 2:594262-594284 CTTACTTCGCAGAAGGAATTCGG - Intergenic
925342774 2:3148466-3148488 CTGACTGTGGGGAAGGATGAGGG - Intergenic
925825988 2:7849084-7849106 ATTACTATGGAGAAGGATGAAGG - Intergenic
926272992 2:11381332-11381354 TTTACTTTTGAGAAGGAGGAAGG - Intergenic
926938766 2:18113903-18113925 GTTACTGGGGAGAAGGCAGATGG + Intronic
927266536 2:21159183-21159205 TTTATTTGGGAGCAGGAAGAAGG + Intergenic
927305359 2:21565424-21565446 CTGTCTTTGGAAAAGGAAGCAGG - Intergenic
927431863 2:23033299-23033321 CTTACATGGGGGAAGGCAGAAGG + Intergenic
927723464 2:25402918-25402940 CTTTCTTAGTAGAAGGAAGAAGG + Intronic
928717841 2:34083302-34083324 TTCACATGGGAGAAGGAAGAAGG + Intergenic
929303643 2:40334565-40334587 TCTACCCTGGAGAAGGAAGAAGG + Intronic
929562675 2:42965517-42965539 CTTAGGCTGGAGAAGGGAGATGG + Intergenic
930234345 2:48874591-48874613 CATAGTTTGTAGAAGGAAGGAGG + Intergenic
930275712 2:49308797-49308819 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
930894940 2:56435080-56435102 CTGACTTTGTAGAATGAATATGG + Intergenic
931052922 2:58434205-58434227 CTGACTTTGAAGATGGAGGAAGG - Intergenic
931418942 2:62107959-62107981 ATTCCTTTTGAGAAGGAATAGGG - Intronic
932117083 2:69061360-69061382 CTGAAATTGGACAAGGAAGAAGG - Intronic
933194349 2:79371626-79371648 CCTACTTTGCAGGAGGAACATGG + Intronic
934611802 2:95743911-95743933 CTCACTGTAGAGAAGGAAGGAGG + Intergenic
934977253 2:98811669-98811691 GTTACATAGGGGAAGGAAGAAGG - Intronic
935811016 2:106797163-106797185 TTTTCCTTGGAGAAGGGAGACGG + Intergenic
935830902 2:106999874-106999896 CAGACTTTGGAGAAGAGAGACGG + Intergenic
936545138 2:113385529-113385551 CTCACTGTAGAGAAGGAAGGAGG + Intergenic
937544407 2:122999546-122999568 CTTACTTCTGAGAATGAACAAGG - Intergenic
937970091 2:127542558-127542580 CATACTATGGATAAGGATGAAGG + Intronic
938394370 2:130931487-130931509 CATACTACAGAGAAGGAAGAGGG - Intronic
938998474 2:136705950-136705972 CTGACTTTGAAGATGGAGGAAGG + Intergenic
939231309 2:139429640-139429662 CTTAGTTTGGAAATGGAAGTGGG - Intergenic
939462299 2:142512876-142512898 TACACTATGGAGAAGGAAGAAGG + Intergenic
940231865 2:151463184-151463206 ATTACTTTGGAGAAGTTTGATGG + Exonic
940298869 2:152158783-152158805 CTTACATGGCAGAAGGTAGAAGG + Intronic
940363245 2:152818176-152818198 TTGGCTTTGGAGAAGAAAGATGG - Intergenic
941233825 2:162944480-162944502 CTTAGTTTGGGGAAAGAAGAGGG + Intergenic
941551928 2:166927524-166927546 CTGGCTTTGAAGATGGAAGAAGG - Intronic
942614492 2:177776331-177776353 CTTAATTTGGAGCATGTAGAAGG - Intronic
942856042 2:180549837-180549859 CTGGCTTTGAAGAAGGAAGATGG - Intergenic
943778383 2:191793311-191793333 CTCGCTTTGAAGATGGAAGAAGG - Intergenic
943956538 2:194199120-194199142 CTTATTTTGAAGATGGAAGGGGG + Intergenic
944169611 2:196760267-196760289 GTTACTTTTGAGATGGAACAGGG + Intronic
944456752 2:199902867-199902889 CATATTTTGGAGTAGGAAGAGGG + Intergenic
944510403 2:200459222-200459244 CTTACTCGGGAGAATGAAAAAGG + Intronic
944630852 2:201622558-201622580 CTGGCTTTGAAGATGGAAGAGGG - Exonic
944932714 2:204536214-204536236 CTTGCTTTGGAGGAGAAAGAGGG + Intergenic
945322016 2:208435556-208435578 CTGACTTCGAAGATGGAAGAAGG + Intronic
945753649 2:213819427-213819449 CTTCCTTTTCAGAAGGTAGATGG + Intronic
946425110 2:219590483-219590505 CTGGCTTTGGAGATGGAAGGGGG + Intergenic
946425925 2:219596669-219596691 CTTGCCTTGGGGAAGAAAGAAGG + Intergenic
947205484 2:227657296-227657318 CAGCGTTTGGAGAAGGAAGAAGG + Intergenic
947364262 2:229378069-229378091 CTGACTTTGAAGAAGGCAGAAGG + Intronic
947846561 2:233249139-233249161 ATTAATTTGGAGAAGTCAGAAGG + Intronic
948281103 2:236748579-236748601 CTTGCATTGAAGGAGGAAGAGGG - Intergenic
1169133421 20:3180425-3180447 CTGGCTTTGCAGATGGAAGAAGG + Intergenic
1169883434 20:10372111-10372133 CTTGCTTTGGGGAAGAAAAAGGG - Intergenic
1170116510 20:12865894-12865916 CATACATGGGAGCAGGAAGAAGG + Intergenic
1170187899 20:13612275-13612297 CTCGTTTTGGAGAAGGAAAAAGG - Intronic
1170822403 20:19765749-19765771 CTTACTTCATAAAAGGAAGAGGG - Intergenic
1171320963 20:24243951-24243973 CTCACCTTAGAGAAGGCAGAAGG + Intergenic
1172417495 20:34782821-34782843 TGTAGTTTGGAGAAAGAAGAAGG - Intronic
1172597938 20:36163229-36163251 CTTCCCTTGGAGAAGGAAATAGG - Intronic
1173190743 20:40873855-40873877 CTGACTTTGAAGATGGAGGAGGG + Intergenic
1173732010 20:45335641-45335663 CCTTTTTTTGAGAAGGAAGAAGG + Intronic
1174073682 20:47916788-47916810 CTTCCTTAGGAGTGGGAAGAAGG + Intergenic
1176798423 21:13394968-13394990 ATTATTTTGGCTAAGGAAGAGGG - Intergenic
1177180546 21:17740182-17740204 CTTGCTTTGAAGCAGAAAGAGGG + Intergenic
1177181930 21:17753708-17753730 CTCAGTTTGGGGGAGGAAGAGGG - Intergenic
1177702063 21:24652348-24652370 GTTACCTTTGGGAAGGAAGAGGG - Intergenic
1178072970 21:28989655-28989677 CATAATTTGAAGAAGGGAGAAGG - Intronic
1180722406 22:17919379-17919401 CTTACATTGTAGCAGAAAGATGG - Intronic
1182096432 22:27629144-27629166 CGTGCTTTGAAGATGGAAGAGGG - Intergenic
1182376248 22:29850530-29850552 CTTGCATGGCAGAAGGAAGAAGG + Intergenic
1182909015 22:33964825-33964847 GCTACTTTGGATAATGAAGATGG - Intergenic
1183272622 22:36871633-36871655 CTTGCTGTGGAGAGAGAAGAGGG - Exonic
1184422190 22:44388764-44388786 CTGGCTTTGGAGATGGAAGAAGG + Intergenic
1185181256 22:49364649-49364671 CTGGCTTTGGAGATGGAGGAGGG + Intergenic
949312103 3:2711502-2711524 CCTACTTTTCTGAAGGAAGAAGG + Intronic
949360190 3:3223484-3223506 TTTACTTGGGAAGAGGAAGAAGG + Intergenic
949374182 3:3368591-3368613 CTTACTATGAACCAGGAAGAAGG + Intergenic
949401396 3:3668681-3668703 ATGACTTTGAAGAAGGAGGAAGG - Intergenic
949797158 3:7863833-7863855 AATGCATTGGAGAAGGAAGATGG + Intergenic
949875131 3:8621522-8621544 ATGACATTGCAGAAGGAAGAGGG + Intronic
950931368 3:16792210-16792232 CTTGCTTTGGAGGAGAAAGAGGG - Intergenic
950973016 3:17208577-17208599 CTAACTTTGGGGAAGGAAGTAGG - Intronic
950977737 3:17267362-17267384 CTGACATTGAAGAAGGAAAAAGG - Intronic
954834761 3:53456264-53456286 ATTACTTTGGAGTGGGATGATGG + Intergenic
954989235 3:54825255-54825277 CCTTCTGTGTAGAAGGAAGAAGG - Intronic
957165587 3:76668899-76668921 CTTTCTTTGGAGGAAGAGGATGG + Intronic
958477532 3:94603892-94603914 GTTCCTTTGGAGAAGGACTAGGG + Intergenic
958489944 3:94759772-94759794 CATATTCTGGAAAAGGAAGATGG + Intergenic
958970251 3:100603158-100603180 CAGACTTTGGAGATGGAAAATGG + Intergenic
959191032 3:103112114-103112136 TTGACTCTGAAGAAGGAAGAAGG + Intergenic
960636948 3:119793551-119793573 CTGGCTTTGAAGATGGAAGAAGG - Intronic
960648997 3:119925215-119925237 GTTACTTGGGAGAAGGAGGTGGG + Intronic
961096372 3:124160008-124160030 CATACCTTGGTGAAGGAAGGTGG + Intronic
961265049 3:125634921-125634943 CTTGGTGGGGAGAAGGAAGATGG + Intergenic
962074746 3:132069995-132070017 CTCATTTTGGGGAAGAAAGAGGG - Intronic
962226356 3:133613665-133613687 CTGACTTTGAGGAAAGAAGAAGG + Intronic
962494575 3:135926423-135926445 CTTATAGGGGAGAAGGAAGAGGG - Intergenic
962627725 3:137243307-137243329 TTTTCTTTGGAAAAGGAATATGG + Intergenic
963285614 3:143431787-143431809 CTGAGTTTAGAGAAGTAAGAGGG - Intronic
963308621 3:143682763-143682785 CTGACTTTGAAGATGGAGGAAGG - Intronic
963713550 3:148776173-148776195 CTTACATGGTAGAAGGCAGAAGG - Intergenic
963817135 3:149843989-149844011 CTAACTTTGGGGAAGGGAAAGGG - Intronic
964577697 3:158193058-158193080 GTTATTTGGGAGAAGGAAGCAGG - Intronic
964702015 3:159578686-159578708 CTGACTTTGAAGATGGAAAAAGG - Intronic
965379755 3:167973886-167973908 GTTGCTGTGGACAAGGAAGAAGG - Intergenic
966223241 3:177570972-177570994 CCTGTTTTGGGGAAGGAAGATGG + Intergenic
967632435 3:191760860-191760882 CTTACAATGTAGTAGGAAGAGGG + Intergenic
969078698 4:4601491-4601513 CTTATTTCGGAGACAGAAGATGG - Intergenic
969692919 4:8715832-8715854 CCTACATTAGAGAAGGAAAATGG + Intergenic
970467889 4:16345969-16345991 CTGTCTTTGAAGATGGAAGAAGG - Intergenic
970608541 4:17704796-17704818 CTCCCTTTGGAGAAGGCATAAGG + Intronic
971276109 4:25198548-25198570 CTTACCTCTGAGAAGGAAAATGG + Intronic
971391808 4:26193024-26193046 CTGGCTTTGAAGATGGAAGAAGG + Intronic
971629421 4:28970876-28970898 CTTAAATTGGAGAACAAAGAAGG - Intergenic
972002475 4:34056575-34056597 CTTACTTTTGAGAAGTATGCAGG - Intergenic
972048425 4:34697561-34697583 TACAGTTTGGAGAAGGAAGATGG + Intergenic
973628771 4:52798777-52798799 CTGACTTTGAAGATGGAGGATGG + Intergenic
974670200 4:65020540-65020562 TGTGCTTTAGAGAAGGAAGAAGG + Intergenic
974888840 4:67853718-67853740 CTTTAGTTGGATAAGGAAGAGGG + Intronic
975100724 4:70509972-70509994 CTTATTTTTGAAAAAGAAGAAGG + Intergenic
975282896 4:72583243-72583265 CTGGCTTTGGACAGGGAAGAAGG + Intergenic
976484481 4:85585681-85585703 CTTTCCTTGGAGATGGAATAAGG - Intronic
977464601 4:97368029-97368051 CTTGCTTTGAAGATGGAGGAAGG - Intronic
977511124 4:97964223-97964245 CTTACTGGGGACAAGGCAGATGG + Intronic
977564693 4:98568993-98569015 CTCACTGTGGAGAAGGATGCAGG + Intronic
977798198 4:101193669-101193691 TTTATTTTGGAGAAGTCAGAAGG - Intronic
977911508 4:102542577-102542599 CTTACCTAAGAGAAGGAAGGAGG - Intronic
978298691 4:107239747-107239769 CTGGCTTTGTAGAATGAAGAAGG - Intronic
978306835 4:107338148-107338170 CTGACTTTGAGGATGGAAGATGG + Intergenic
978326278 4:107560813-107560835 TTTCCTTTGGAGAAGTAACATGG - Intergenic
978661039 4:111126619-111126641 CTGACTTTGAAGATGGAGGAAGG + Intergenic
978740862 4:112136378-112136400 CTCATTTGGCAGAAGGAAGAAGG + Intergenic
978875699 4:113637992-113638014 CATATTTGGGAGAAGGAGGATGG - Intronic
979266805 4:118712899-118712921 TTCACTGTGGAGAAAGAAGAGGG + Exonic
979746376 4:124218596-124218618 TTTACTCTGCAGAAGGTAGAGGG + Intergenic
979834739 4:125350770-125350792 CTTACTGTAGAGAATGAGGAGGG - Intronic
980126927 4:128783261-128783283 GTTGCTTTGGGGGAGGAAGAGGG + Intergenic
980383749 4:132060525-132060547 CTGCCTTTGAAGAGGGAAGAAGG + Intergenic
980493044 4:133554204-133554226 CTAACTTTGTAGAAGGGATATGG + Intergenic
980545513 4:134256454-134256476 TTTATTTTGTAGAACGAAGAAGG + Intergenic
980975948 4:139610623-139610645 CTTCCTTTGAAGATAGAAGATGG + Intergenic
981291598 4:143082728-143082750 CTGACTTTGAAGATGGAAGAAGG + Intergenic
983378624 4:166962037-166962059 CCTTCTTTGAAGAAGGAAGGGGG - Intronic
983873625 4:172851051-172851073 CATTCTCTGGAGAAGGAAGGGGG - Intronic
983913442 4:173265700-173265722 ATTGCTTCAGAGAAGGAAGAAGG - Intronic
984333639 4:178359383-178359405 ATTAATTTAGAGAAGGGAGATGG + Intergenic
984883197 4:184428353-184428375 AGGAATTTGGAGAAGGAAGAGGG + Intronic
984912290 4:184685465-184685487 CTTTCTTTGGTGAATAAAGATGG + Exonic
986346746 5:6842942-6842964 CTTACATTGAAAAAAGAAGATGG - Intergenic
986647474 5:9931671-9931693 CTTACATTAGATAAGGAAGGAGG + Intergenic
987239026 5:15973488-15973510 CTGGCTTTGGAGATGGAGGAAGG + Intergenic
987824318 5:23008700-23008722 CTCACATGGGAGAAGGCAGAAGG - Intergenic
987960492 5:24802441-24802463 CTGACTTTAAAGATGGAAGAAGG - Intergenic
987961470 5:24814585-24814607 CTGAATTTGGATGAGGAAGAGGG + Intergenic
988261201 5:28887747-28887769 CTTACTCTGGTGAGAGAAGAGGG - Intergenic
988497687 5:31758737-31758759 CAAACTCTGGAGAATGAAGATGG - Intronic
989005603 5:36808782-36808804 ATTACTTTGGAAAAGGAAGAAGG + Intergenic
989415226 5:41167388-41167410 CCTACTTTTGAGAAGGAAAATGG - Intronic
989684922 5:44074428-44074450 CATACTGAGGAAAAGGAAGAAGG + Intergenic
990334867 5:54762698-54762720 CCAACTTTGGAGATGGAGGAAGG - Intergenic
990356753 5:54975248-54975270 CTTATTTTAGAGAAGGAGGCAGG - Intergenic
992212865 5:74497477-74497499 CTTACATGGCAGAAGGAAGAGGG - Intergenic
993033164 5:82727895-82727917 CTCACTTTACAGAAGAAAGAGGG + Intergenic
993225723 5:85165779-85165801 CTTACATCAGGGAAGGAAGAAGG - Intergenic
993386196 5:87266539-87266561 GCTACCTGGGAGAAGGAAGATGG - Intergenic
993664225 5:90675320-90675342 ATCACTGTGGAGGAGGAAGATGG + Exonic
993800616 5:92330634-92330656 CTTACTTTTGAGTAGGGATATGG + Intergenic
994997321 5:107080173-107080195 CTTACTTTGAGGGAGGAAGATGG - Intergenic
995073875 5:107958462-107958484 CTTTCTTTTCAGAAGGAAGTAGG - Intronic
995412404 5:111873572-111873594 CTTGCTTTGAAGATGGAGGAAGG - Intronic
995575324 5:113525000-113525022 CTAACTGTGAAGAAGAAAGATGG + Exonic
995708243 5:115007688-115007710 CTTACTTTGGAAGAGGAAGAAGG + Intergenic
996016391 5:118538611-118538633 CTCACTTTGCAGATGGAAGACGG - Intergenic
996300715 5:121981023-121981045 CTTACTTGGAGGAAAGAAGATGG - Intronic
996823940 5:127660293-127660315 CTTGCTCTGGACAAGGAAGGAGG - Intergenic
996981649 5:129502954-129502976 GTTACTTTGGAGAAAGGACAGGG + Intronic
997553926 5:134778427-134778449 CTTACATTTTAGAAGGGAGAAGG - Intronic
999286881 5:150399438-150399460 TTTCCTTTTGGGAAGGAAGATGG + Intronic
999361257 5:150988541-150988563 CTTAGGTTGGAGAGGGGAGAAGG + Intergenic
999532035 5:152474443-152474465 CATACTTTGGTTGAGGAAGACGG - Intergenic
1000299105 5:159939188-159939210 TTTTCATTTGAGAAGGAAGAGGG + Intronic
1001113487 5:168918853-168918875 TTGACTTTGAAGAAGGAAGTTGG - Intronic
1002321230 5:178377321-178377343 CTTCCCTTGGAAAAGGAAGGAGG - Intronic
1002668082 5:180841751-180841773 CATACTATGAAAAAGGAAGAAGG + Intergenic
1004205482 6:13587935-13587957 TTTACTTTTATGAAGGAAGATGG + Intronic
1004496877 6:16172740-16172762 CTTATTTTGGTGAAGGAAAGTGG + Intergenic
1004736918 6:18416069-18416091 GTTTCTTTGGAGAAAGTAGAAGG + Intronic
1004888302 6:20072719-20072741 CTGGCTTTGAAGATGGAAGAGGG - Intergenic
1005347429 6:24904347-24904369 CTGACTTTGAAGATGGAGGAAGG - Intronic
1005618837 6:27601629-27601651 CTTTCTTTGGTGATGGGAGAAGG - Intergenic
1006404481 6:33836490-33836512 CTACCTTTGGAGAGGGAAGGAGG + Intergenic
1007027351 6:38589886-38589908 CTTAAGGTAGAGAAGGAAGAAGG - Intronic
1007841528 6:44720147-44720169 CTCACCTTGGAGAAGGAAACAGG - Intergenic
1008147256 6:47906989-47907011 CCTACTTTGGAAAACAAAGATGG - Intronic
1009785501 6:68333138-68333160 CTGACTTTGAAGATGGAGGAAGG - Intergenic
1009864311 6:69377343-69377365 CTTACTTTGGAGGAGAATAAGGG - Intronic
1010010994 6:71048059-71048081 AGTACTTTGGGGAAGGAAGCAGG + Intergenic
1010329507 6:74606689-74606711 CTTAATTTGTGGAAGGAACATGG - Intergenic
1010941051 6:81917973-81917995 TTTACTTTGGAGCAGGATAAGGG + Intergenic
1011030535 6:82918064-82918086 CTTACTTGGGAGAAAGAATTTGG - Intronic
1011062379 6:83285512-83285534 CATGCTGTAGAGAAGGAAGAAGG + Intronic
1011519109 6:88184656-88184678 GTTTCTTTGGCGAAGGGAGAAGG - Intergenic
1012213316 6:96551126-96551148 CTTCCATTAGAGTAGGAAGAGGG - Intronic
1013170925 6:107635518-107635540 CTTACTTCTGACAAGGCAGAGGG + Intronic
1013230290 6:108156604-108156626 GTTTCTTTGGGGAAGGAAGGAGG - Intronic
1014014785 6:116517818-116517840 CAGACCTTGGGGAAGGAAGAGGG + Exonic
1014398026 6:120950799-120950821 CATACTTAAGAGAAAGAAGATGG + Intergenic
1014410877 6:121118764-121118786 CTGACTTTGGGAAAGGAAGCAGG - Intronic
1014791588 6:125678586-125678608 CTTACAATAAAGAAGGAAGAAGG - Intergenic
1016017092 6:139197866-139197888 CTCACTTGGCAGAAGGCAGAAGG + Intergenic
1016083928 6:139889045-139889067 CTTACTGGGGAGAACAAAGACGG + Intergenic
1016313081 6:142755898-142755920 GTTTCTTTGGAGGATGAAGAAGG - Intronic
1016587346 6:145704982-145705004 ATCACATTGAAGAAGGAAGATGG + Intronic
1017099162 6:150832221-150832243 CTTACTTTGGAGAAGGAAGAAGG - Intronic
1017301144 6:152859534-152859556 CTTAGTTTGGGGAGAGAAGAGGG + Intergenic
1017632779 6:156413700-156413722 CTCATTTTGAAGATGGAAGACGG + Intergenic
1017756087 6:157530969-157530991 CCTACTTTGCAAAAGAAAGAAGG + Intronic
1018719676 6:166563219-166563241 GTGTCTCTGGAGAAGGAAGATGG + Intronic
1019398945 7:840090-840112 CTTTCTCTCGAGAAGGAAGACGG + Intronic
1020033182 7:4947349-4947371 CTTACATGGGAGCAGGAGGAAGG + Intronic
1020401260 7:7780212-7780234 CTTAGTTTGAAGAAGAGAGATGG - Intronic
1020496141 7:8855334-8855356 CTTGCTTGGGAGATGGGAGATGG + Intergenic
1020572045 7:9875852-9875874 CTAACTTTGAAGATGGAAGAAGG - Intergenic
1021088101 7:16447790-16447812 TTTATATTGGAAAAGGAAGAAGG - Intergenic
1021098458 7:16560451-16560473 CTTATTTTGGAGACGTGAGAAGG + Intronic
1021899053 7:25264839-25264861 CTTCCTTTGGGAGAGGAAGAGGG + Intergenic
1022194759 7:28054064-28054086 TTTACTTTTCAGAATGAAGATGG - Intronic
1022891278 7:34702395-34702417 CTTCCTTAGGAAAAGGAAGCTGG - Intronic
1023310458 7:38881274-38881296 CTAGCTTTGAAGAGGGAAGAAGG - Intronic
1023381509 7:39612870-39612892 CCGGCTTTGGAGATGGAAGAGGG + Intergenic
1023474571 7:40563046-40563068 GTTACTTGGGCGGAGGAAGAGGG - Intronic
1023801161 7:43836029-43836051 ATTACTTTGGTGAAGGAACGTGG + Intergenic
1023968794 7:44977188-44977210 CTGAGAGTGGAGAAGGAAGAAGG + Intronic
1024661429 7:51498870-51498892 CTTTCTTTGGTGAATAAAGAGGG + Intergenic
1024683647 7:51720381-51720403 CTTACATGGCAAAAGGAAGAAGG - Intergenic
1026120361 7:67531565-67531587 CTCACTTTGGAAATGGAGGAAGG - Intergenic
1026457414 7:70584738-70584760 CTTGCTCTGAAGAAGGAAGGGGG + Intronic
1027184891 7:75965155-75965177 CTGACTTGGAAGCAGGAAGATGG + Intronic
1027854547 7:83492620-83492642 CATACTTTGGAGAAAGCAGAGGG + Intronic
1028123637 7:87086087-87086109 CTGGCTTTGAAGATGGAAGATGG + Intergenic
1028144872 7:87310574-87310596 CTTATTTTGTAAAAGGTAGAAGG - Intergenic
1028318826 7:89436155-89436177 CTTAGTTTGGAGAAGGGAGGAGG - Intergenic
1028534782 7:91880541-91880563 TTGTCTTTGGAGGAGGAAGAGGG - Intronic
1029689774 7:102173599-102173621 CTTCCTTTGCAGAATGAAGCAGG - Intronic
1030195735 7:106851769-106851791 CTTACTTGGCAGAAGGCAAAAGG + Intergenic
1030552771 7:110985060-110985082 CCAACTTTGAAGATGGAAGAGGG + Intronic
1030629100 7:111875658-111875680 CTGACTTTGAAGATGGAGGAAGG + Intronic
1031142223 7:117956024-117956046 GTTACTTTGGAGAAAGAAGGAGG + Intergenic
1032411249 7:131694506-131694528 CCTAGCTTGGAGCAGGAAGATGG - Intergenic
1033193929 7:139310398-139310420 GTTGCTCTGGGGAAGGAAGATGG - Intergenic
1033656665 7:143380179-143380201 CTTAGTTTGGAGAAAGAACTGGG + Intergenic
1033668810 7:143469782-143469804 CTTACATTGTAGAAGGCAGAAGG - Intergenic
1033733048 7:144196620-144196642 CCTAAGTAGGAGAAGGAAGAGGG - Intergenic
1033743900 7:144295200-144295222 CCTAAGTAGGAGAAGGAAGAGGG - Intergenic
1033750001 7:144354367-144354389 CCTAAGTAGGAGAAGGAAGAGGG + Intergenic
1033803443 7:144927504-144927526 CTTACCTTTGACAAGGAAAATGG - Intergenic
1034006280 7:147475790-147475812 TTTATTTTGGCAAAGGAAGAAGG + Intronic
1036433092 8:8707635-8707657 ATTACTTGGCACAAGGAAGAGGG - Intergenic
1037126107 8:15352001-15352023 GTTACCTTGGAGGAGGAAGGAGG + Intergenic
1037358112 8:18044299-18044321 CTGACTTTGAAGATGGAAAAAGG - Intergenic
1037396788 8:18451884-18451906 CTGGCTTTGGAGAATGAGGAAGG - Intergenic
1037607081 8:20447202-20447224 CTTGCTTTGGGGAAAGAAGAAGG + Intergenic
1037715016 8:21390300-21390322 CTTACTTGGGAGAAAGAATTCGG + Intergenic
1037740645 8:21606335-21606357 CTTACATGGCAGAAGGCAGAAGG - Intergenic
1039099792 8:33928802-33928824 CTCACTTGGGAGAAGGAAGCTGG - Intergenic
1039378155 8:37058081-37058103 CTCACTTTGGAGCAGGAACTTGG + Intergenic
1040953145 8:52955647-52955669 CTAACTTTGGAGAAGAGAGGCGG - Intergenic
1041181092 8:55248927-55248949 CTTGATTTGGCAAAGGAAGATGG + Intronic
1041405915 8:57499096-57499118 ATGACTTGGGAGAAGGTAGATGG - Intergenic
1041991002 8:63991627-63991649 CTTACTTTTAAGATGGAGGAGGG - Intergenic
1042366924 8:67947814-67947836 CTGACTTTGAAGATGGAGGAAGG - Intergenic
1044069063 8:87733495-87733517 CTTACTTTTAAGAAGTAAGGAGG - Intergenic
1044802863 8:95975061-95975083 CTGCCTTTGGAGATGGAGGAGGG + Intergenic
1044914925 8:97103002-97103024 TATACTTTGAAGATGGAAGAAGG - Intronic
1045037912 8:98190958-98190980 CTTACTTTGGAGCAACAATATGG + Exonic
1045857863 8:106784650-106784672 GTTCCTATGGGGAAGGAAGAAGG - Intergenic
1046012221 8:108563014-108563036 CTAACTGTGGGGAAGGCAGATGG + Intergenic
1046501620 8:115085088-115085110 CTGACTTTGAAGAAGGAGAAAGG + Intergenic
1047033735 8:120912537-120912559 CTCACCTTGGATAAGAAAGAAGG + Intergenic
1047097627 8:121641411-121641433 CTTAAGTTGGAGGAGGCAGAAGG - Intergenic
1047301030 8:123613531-123613553 CTCACTTTGTAGGAGAAAGAGGG + Intergenic
1047638384 8:126791917-126791939 CTGGCTTTGAAGAAGGAAAATGG - Intergenic
1047733188 8:127743417-127743439 CTGACTTTCGGGAAGGAAGTTGG - Intergenic
1047992495 8:130300793-130300815 CTTCCTTTGGCCAAGAAAGAAGG + Intronic
1048744250 8:137595773-137595795 CTGTCTTTGGAGAAGGGAGGTGG + Intergenic
1049619928 8:143593501-143593523 CTCCCGTTGGTGAAGGAAGACGG - Intronic
1049965301 9:774021-774043 GTTACTTTGGAGAATGAGGCAGG + Intergenic
1050063931 9:1738850-1738872 CCTAATTTGGAGAAGGAGGAGGG - Intergenic
1050810741 9:9743609-9743631 ATGCCTTTGGAAAAGGAAGAGGG - Intronic
1051873791 9:21769314-21769336 CATAGTTTGGACTAGGAAGAAGG + Intergenic
1052788622 9:32853357-32853379 CTTACTCTGGAGAATGAAGTGGG + Intergenic
1053061200 9:35033376-35033398 ATTACTTTTGGGAAGGATGAAGG + Intergenic
1053369188 9:37546231-37546253 CTTACTATGGTGTAAGAAGATGG + Intronic
1054742897 9:68826659-68826681 CTTATTTGGGAGAAAAAAGAGGG + Intronic
1055058964 9:72049253-72049275 CTGACTTTGAAGAGGGAGGAGGG - Intergenic
1055740009 9:79377642-79377664 CTCACTTTGGTGGAGAAAGAGGG + Intergenic
1056384185 9:86081922-86081944 TTTCCTTTGGAGTAGGATGAGGG - Intronic
1056667343 9:88591113-88591135 CTCTCTTGGGAGCAGGAAGAGGG + Intergenic
1056816004 9:89801498-89801520 CTCACGTGGGAGAAGGAAAAAGG - Intergenic
1056977535 9:91272684-91272706 CTTACATTCGAGGAGGCAGACGG - Intronic
1057923021 9:99114570-99114592 CTTAAACTGGAGAAGAAAGATGG - Intronic
1058041922 9:100312108-100312130 TTTGTTTTGGAGTAGGAAGATGG - Intronic
1058146622 9:101419156-101419178 TTTACTCTGAAGAGGGAAGAGGG - Intergenic
1058205363 9:102099616-102099638 CTTACTCTGAAGAATGAACATGG - Intergenic
1058585897 9:106505805-106505827 CTGGCTTTGCAGAAGGAGGAAGG - Intergenic
1058714908 9:107714872-107714894 CTTACTTTGGTGAAGCAACTGGG - Intergenic
1059152613 9:111963153-111963175 CTGACTTTGAAGATGGAAGAAGG + Intergenic
1059977407 9:119732101-119732123 CTGCCTTTGGAGACAGAAGAAGG + Intergenic
1060607563 9:124930172-124930194 CTTACGTTAGAGAAGGGACAGGG - Intronic
1060912142 9:127359513-127359535 CACAGTTTTGAGAAGGAAGAAGG - Intronic
1061115597 9:128609061-128609083 CTTACCGTGGAGAAGGAAGTGGG - Intronic
1062046377 9:134426376-134426398 CTTACATCCGAGAAGGAGGAGGG + Intronic
1062438000 9:136555359-136555381 CTTTCTTTGGAGAAGGGACTAGG - Intergenic
1186129203 X:6448203-6448225 CTGGCTTTGAAGAAGGAGGAAGG - Intergenic
1186432422 X:9516308-9516330 TTTATTTTGGAGAAGGAAGTGGG - Intronic
1186449166 X:9657682-9657704 CTTGCTTTGGACAAGTAACAAGG - Intronic
1186652560 X:11576941-11576963 CTGGCTTTGAAGAAGGAGGAAGG - Intronic
1187082723 X:16007979-16008001 CTAAATTTGGAGAATGAGGAAGG + Intergenic
1188434466 X:30145150-30145172 CTGACTTTGAAGACGGAGGAAGG + Intergenic
1188638510 X:32466731-32466753 CTGACTTTGAAGATGGAGGATGG + Intronic
1188660600 X:32753099-32753121 CTTGTTGTGGAGAAGGAAGAGGG - Intronic
1188964607 X:36536107-36536129 CTCACTTTGGTGGAGAAAGAGGG - Intergenic
1189124769 X:38434809-38434831 CTCACTTGGCAGAAGGCAGAAGG + Intronic
1190061704 X:47215747-47215769 CCTACTTTGGAGAAGACAGCTGG + Intergenic
1190576675 X:51846364-51846386 CCTACTTTGAAGATGGAAGATGG + Intronic
1190791630 X:53706064-53706086 CTGACTTTGAAGATGGAGGAGGG + Intergenic
1191901491 X:66045337-66045359 CTAACTTTGAAGATGGAGGAAGG + Intergenic
1192589515 X:72348229-72348251 ATTGCTTTGGAGAGGTAAGATGG - Intronic
1192783773 X:74318933-74318955 CAGACTTTGGATAAGGGAGAAGG - Intergenic
1193679312 X:84498782-84498804 CTAACTTTGTAGAAGTAATATGG + Intronic
1193866472 X:86737982-86738004 CTGGCTTTGAAGATGGAAGAAGG - Intronic
1194668186 X:96698598-96698620 TTTTCTTTGGGGAAGGATGATGG - Intronic
1196560083 X:117135754-117135776 CTGGCTTTGAAGATGGAAGATGG + Intergenic
1196583469 X:117402402-117402424 CTCAAAATGGAGAAGGAAGATGG - Intergenic
1196622438 X:117839085-117839107 AGTGCTGTGGAGAAGGAAGAAGG + Intergenic
1197284032 X:124574343-124574365 CTAATATTGGAGAAGGCAGAGGG - Intronic
1197949048 X:131874437-131874459 ATTACTTTGCAGACAGAAGAAGG + Intergenic
1197986629 X:132272641-132272663 CTTATTTGGGAGCAGGGAGAGGG - Intergenic
1198953274 X:142097587-142097609 CTGGCTTTGAAGATGGAAGAAGG - Intergenic
1199322184 X:146453276-146453298 CTCACTTAAGAGGAGGAAGAGGG - Intergenic
1199523486 X:148765247-148765269 TTCACCTTGGAGAAGGAAAAGGG - Intronic
1201389039 Y:13477352-13477374 CATTCTTTGGAGAAGGTGGAAGG - Intronic
1201643527 Y:16202960-16202982 CTTAGTTTGGACAAGGTAGGAGG - Intergenic
1201659288 Y:16382361-16382383 CTTAGTTTGGACAAGGTAGGAGG + Intergenic