ID: 1017103228

View in Genome Browser
Species Human (GRCh38)
Location 6:150866158-150866180
Sequence TTGGTGCCAACTCATTAGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 72}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017103222_1017103228 9 Left 1017103222 6:150866126-150866148 CCGTGGGGAGCGGGGCGCGGGGC 0: 1
1: 0
2: 3
3: 68
4: 457
Right 1017103228 6:150866158-150866180 TTGGTGCCAACTCATTAGGGGGG 0: 1
1: 0
2: 0
3: 6
4: 72
1017103213_1017103228 19 Left 1017103213 6:150866116-150866138 CCCGGGACCGCCGTGGGGAGCGG 0: 1
1: 0
2: 2
3: 16
4: 269
Right 1017103228 6:150866158-150866180 TTGGTGCCAACTCATTAGGGGGG 0: 1
1: 0
2: 0
3: 6
4: 72
1017103218_1017103228 12 Left 1017103218 6:150866123-150866145 CCGCCGTGGGGAGCGGGGCGCGG 0: 1
1: 0
2: 3
3: 27
4: 246
Right 1017103228 6:150866158-150866180 TTGGTGCCAACTCATTAGGGGGG 0: 1
1: 0
2: 0
3: 6
4: 72
1017103215_1017103228 18 Left 1017103215 6:150866117-150866139 CCGGGACCGCCGTGGGGAGCGGG 0: 1
1: 0
2: 1
3: 12
4: 173
Right 1017103228 6:150866158-150866180 TTGGTGCCAACTCATTAGGGGGG 0: 1
1: 0
2: 0
3: 6
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017103228 Original CRISPR TTGGTGCCAACTCATTAGGG GGG Intronic
908893029 1:68866915-68866937 TGGCTGCTAACTGATTAGGGTGG + Intergenic
909695865 1:78467069-78467091 TGGCTGCCAACTCATCAGGGTGG - Intronic
914265971 1:146038720-146038742 TTGGTCCCAGCTACTTAGGGAGG + Intergenic
917400040 1:174637669-174637691 TTCGTGCCTCCTCATGAGGGAGG + Intronic
919037593 1:192334926-192334948 TTTGTGCAAACTCATTAGGCAGG - Intronic
921233251 1:213095887-213095909 TGGCTGCCAACTGATCAGGGTGG + Intronic
1064501722 10:15980731-15980753 TAGGTGCCAAGTCAATAGGAGGG + Intergenic
1065482969 10:26213241-26213263 TTGGTGCCAACTCTTTGAGTTGG - Intergenic
1066676001 10:37887921-37887943 TTGCTACAAAATCATTAGGGTGG + Intergenic
1069688713 10:70335542-70335564 TTGAAGCCAAGTCATAAGGGAGG - Intronic
1070525594 10:77293327-77293349 GTTGTGCAAACTCATTAGGAGGG - Intronic
1078015353 11:7608762-7608784 TTATTGCCAACTCATTTGGAGGG + Intronic
1079569044 11:21920182-21920204 TCTGTTCTAACTCATTAGGGTGG + Intergenic
1087339793 11:96889216-96889238 TAGCTGCCAACTGATTAGGGTGG + Intergenic
1094384833 12:29883083-29883105 TTGGTGCCAACTCAACAGCAGGG - Intergenic
1095208283 12:39463128-39463150 ATGATGCCTACTCATTTGGGAGG + Intergenic
1095743080 12:45627808-45627830 TTGGGGCCAACTCAAGAGTGTGG + Intergenic
1096180164 12:49546360-49546382 TTGGTGCCAACCCAGTTAGGGGG - Intronic
1103358849 12:120342083-120342105 CTGGTGCCCACTCATTGCGGGGG + Exonic
1106577402 13:30988207-30988229 TTGCTGTTACCTCATTAGGGTGG + Intergenic
1107654771 13:42580437-42580459 TTGGTGTCATCACGTTAGGGTGG - Intronic
1108962850 13:56258086-56258108 GGGGTGCCAACTCATTAAGGTGG - Intergenic
1119225525 14:72942156-72942178 TTGGTGACAACTCATTAGAAGGG - Intronic
1121024112 14:90601811-90601833 TGGCTGCCAAATCATAAGGGCGG + Intronic
1126158760 15:45588938-45588960 TTGGTGCCAATTTCTTAGGAGGG + Intronic
1133205869 16:4233171-4233193 CTGGCCCCAACTCATCAGGGTGG + Intronic
1133897276 16:9941837-9941859 TTAGTGCCAACTTAATAAGGTGG - Intronic
1134212018 16:12285661-12285683 TTGGTGCCAATTTATGAGGCAGG - Intronic
1137367566 16:47873841-47873863 TTGGTGCCAAGGCACTAGGGAGG + Intergenic
1148278205 17:46325284-46325306 TTGGTGACAAATCATTACAGAGG - Intronic
1148300415 17:46543139-46543161 TTGGTGACAAATCATTACAGAGG - Intronic
1148331005 17:46814015-46814037 TTGGTGCCAAGTCCTTTAGGAGG - Intronic
1150402087 17:64866117-64866139 TTGGTGACAAATCATTACAGAGG + Intronic
1160117283 18:76091827-76091849 TGGTTGCCAACTGATCAGGGTGG + Intergenic
925263857 2:2550873-2550895 TTTGTTCCAAATAATTAGGGAGG + Intergenic
929436682 2:41933993-41934015 TTTGTACCAACTCATTGGTGGGG - Intergenic
930264750 2:49186489-49186511 TTGGGGCCAACTCACTAGTAGGG - Intergenic
930351263 2:50258086-50258108 TGGGTGCTTACTGATTAGGGTGG + Intronic
933166746 2:79085097-79085119 GCGATGCAAACTCATTAGGGAGG + Exonic
939165504 2:138637303-138637325 TTGGTGCTAACTCATTATTTCGG - Intergenic
940922348 2:159322792-159322814 TTGGTTCCAACTCATTAATTTGG + Intronic
944546642 2:200805382-200805404 TTGGTGAGAACTCTTTAGGAAGG - Intergenic
944749216 2:202690870-202690892 TTGGTGCCTAATTATTAAGGAGG - Intronic
947035357 2:225847472-225847494 TGGCTGCCGACTCATCAGGGTGG + Intergenic
1170642940 20:18171921-18171943 TGGTTGCCAACTGATCAGGGTGG - Intronic
1172390072 20:34560015-34560037 TTGGTGCCCTCTGACTAGGGGGG - Exonic
1174284233 20:49461021-49461043 TTGGTGCCAACTGGAGAGGGAGG - Intronic
1181821564 22:25479845-25479867 TGGCTGCTGACTCATTAGGGTGG + Intergenic
950529209 3:13543395-13543417 TTGGGGCCAACTCTTCAGGCAGG - Intergenic
951056717 3:18155513-18155535 TTGGTTCCAACTGATGAGGTTGG - Intronic
955733223 3:62009535-62009557 TTGATGGCAAATCATTAGGAAGG - Intronic
960226161 3:115171831-115171853 TTGGTGACAAATAATTGGGGAGG - Intergenic
969310552 4:6350812-6350834 TTGGTGCGATCTCATTGCGGAGG - Intronic
969929680 4:10618834-10618856 ATGGTGCTAACTCATTCGTGAGG + Intronic
972315253 4:37920369-37920391 TTGGAGCCAAATCTTTAAGGAGG + Intronic
975761904 4:77628443-77628465 TGGCTGCTAACTGATTAGGGTGG + Intergenic
978168610 4:105640606-105640628 TTGGTTCTAACTCATTTTGGTGG + Intronic
982079923 4:151779120-151779142 TTGGTTCCAACTTATAAGGATGG + Intergenic
985430437 4:189874326-189874348 TTGCTGCCAACAGATCAGGGTGG - Intergenic
986814439 5:11393012-11393034 TTGGTGCACACTCATGCGGGTGG - Intronic
990512987 5:56505877-56505899 TTGGTGCCTACTTGATAGGGTGG - Intergenic
991330021 5:65484017-65484039 TTGGTGAAAATTGATTAGGGTGG + Intergenic
991966010 5:72091826-72091848 TTTGTGGCAACTTATTAAGGTGG - Intergenic
998038311 5:138935179-138935201 CTCGTGCCAACCCATCAGGGAGG + Intergenic
998366112 5:141632865-141632887 TAGAGGCCAACTCATTAGGCTGG - Intronic
1001781766 5:174374949-174374971 TGGGTGCCACATCACTAGGGTGG - Intergenic
1007549065 6:42715301-42715323 GTGTTGCCAAGTCATTTGGGAGG - Intronic
1011963807 6:93126714-93126736 TGGCTGCTAACTCATTAAGGTGG + Intergenic
1015143008 6:129957287-129957309 ATGATGCCAACTCATAGGGGTGG - Intergenic
1017103228 6:150866158-150866180 TTGGTGCCAACTCATTAGGGGGG + Intronic
1021049236 7:15961890-15961912 TTGGAGCCAAATCGTTATGGTGG + Intergenic
1033084543 7:138330126-138330148 TTGGTGGCAACTCAATTGTGGGG + Intergenic
1036549493 8:9804058-9804080 TTGGTGGCAACTCAATTGTGGGG + Intergenic
1044796649 8:95907493-95907515 TTGCTGCAAACACATTAGGTTGG - Intergenic
1051767261 9:20539059-20539081 TTGCTACCAACTGATCAGGGTGG + Intronic
1051797734 9:20892903-20892925 TGGTTGCTAACTGATTAGGGTGG - Intronic
1056331550 9:85525274-85525296 TTGCTGCCAACACATCAGGCTGG - Intergenic
1188327733 X:28826710-28826732 ATGAAGCCAACTCTTTAGGGGGG + Intronic
1199390643 X:147273749-147273771 GTGGTGCCAAGTAATTAGGATGG + Intergenic