ID: 1017105743

View in Genome Browser
Species Human (GRCh38)
Location 6:150886019-150886041
Sequence AAATTGAGCATGTTTAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 330
Summary {0: 1, 1: 0, 2: 0, 3: 33, 4: 296}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017105743 Original CRISPR AAATTGAGCATGTTTAAAAC AGG (reversed) Intronic
903623774 1:24716702-24716724 AAGCTGAGCAAGTTCAAAACAGG - Intergenic
905132881 1:35774608-35774630 AAATAGAGCACTTTTAGAACTGG - Intergenic
906996776 1:50804025-50804047 AAATTGAACATGTTGGAATCTGG - Intronic
907983767 1:59509971-59509993 AAATTGAGATTTTTTAAAAATGG - Intronic
908363785 1:63396280-63396302 AACTTGAGCACATTAAAAACAGG - Intronic
909949012 1:81696906-81696928 AAAGTGAGCCTGTTGAAAAATGG + Intronic
909972931 1:82011962-82011984 ATATTGAACCTGTTTACAACTGG + Intergenic
910137779 1:83993303-83993325 AAATTGAGCATTTTTAGATTTGG - Intronic
910390585 1:86739067-86739089 AAACTTAACATATTTAAAACTGG - Intronic
913616007 1:120559681-120559703 AAATTTAGCATGATTAGAACTGG - Intergenic
914574271 1:148951217-148951239 AAATTTAGCATGATTAGAACTGG + Intronic
916508480 1:165449898-165449920 AAATTGCCCATTTGTAAAACTGG - Intergenic
916636184 1:166671458-166671480 ATATTGAGCAAATTTAAAGCTGG + Intergenic
918396345 1:184117004-184117026 GCATTTAGCATGTTTAACACTGG + Intergenic
918430857 1:184459391-184459413 AAATTGGGCACTTTTATAACTGG - Intronic
918598403 1:186321229-186321251 TAACTGAGCAAGTTTAAAACTGG + Intronic
918606266 1:186430373-186430395 AAATTGAGCAAGTTGAATAAAGG - Intergenic
918964183 1:191320358-191320380 CAATTGAACAGGTTTAAATCTGG + Intergenic
919424298 1:197410308-197410330 AAAGTGTCTATGTTTAAAACTGG - Intronic
921595217 1:217047304-217047326 AAATTTGGCATGTCCAAAACTGG + Intronic
924590264 1:245397195-245397217 AAAATGAACATGTGGAAAACAGG - Intronic
1063876301 10:10482922-10482944 CAGCTGAGCAGGTTTAAAACTGG - Intergenic
1064611462 10:17106838-17106860 CTATTTAGCCTGTTTAAAACTGG - Intronic
1065533126 10:26693004-26693026 AAATGGAAAAGGTTTAAAACAGG + Intergenic
1065597045 10:27324037-27324059 AAATGGAAAAAGTTTAAAACAGG - Intergenic
1065991022 10:31010564-31010586 AAATTGAACATGTTTAATTAGGG + Intronic
1066616737 10:37302455-37302477 GAATAGAACAGGTTTAAAACTGG - Intronic
1069151244 10:64963444-64963466 AAATTGATCATCTTTACCACAGG - Intergenic
1070237659 10:74646441-74646463 AAATTGAGCTGAATTAAAACAGG + Intronic
1071958998 10:90790187-90790209 ATATTAATCATTTTTAAAACTGG + Intronic
1072134567 10:92532387-92532409 AAATTGAGCCTGTTAAAAGTAGG - Intronic
1074096762 10:110320030-110320052 AAATTCAACATATTCAAAACGGG - Intergenic
1078531184 11:12138000-12138022 AAATCAAGCAGGTGTAAAACTGG - Intronic
1079674258 11:23204170-23204192 AAATGGGGCATATTTAAAAGAGG + Intergenic
1080144881 11:28969507-28969529 AAATTCAGCATGTTCAACATAGG + Intergenic
1080405513 11:31975364-31975386 AAATTCAACATTTTTAAAAATGG - Intronic
1083639520 11:64137886-64137908 AAATTGAGAACCATTAAAACAGG - Intronic
1084279387 11:68077388-68077410 AAAGTGAGCATGGTAAAAAGGGG + Intronic
1086793120 11:91065702-91065724 AAATTGATAATTTTTAAAAAAGG - Intergenic
1087422591 11:97949143-97949165 AAGTAGAGTATGGTTAAAACTGG - Intergenic
1087765484 11:102148166-102148188 TAATAGAGCATGCTTAAAATTGG + Intronic
1087835617 11:102871839-102871861 AAATTCAGCAAGATTAACACAGG - Exonic
1088531984 11:110820314-110820336 AAATTGTGAATGCTTAAAGCTGG + Intergenic
1088917103 11:114235810-114235832 AAATTAAGCTTGTTTTAAATTGG + Intronic
1089475996 11:118762460-118762482 AAGTGGAGCATGTTTAAAGGAGG - Intronic
1090641645 11:128734444-128734466 TAATTCAACCTGTTTAAAACAGG + Intronic
1091984751 12:4900158-4900180 AAACTGAGCATTTTTAAAATAGG - Intergenic
1093351638 12:18109586-18109608 AAATTTAACATGTCTAAAACTGG - Intronic
1093526768 12:20112812-20112834 AAATTGACCATATTTAAACATGG + Intergenic
1094558665 12:31528715-31528737 AAAATCAGTATGTTCAAAACTGG - Intronic
1095716153 12:45348807-45348829 AAACTGAGTATCTTTATAACTGG - Intronic
1096586539 12:52626154-52626176 AAATTAAGCATGTATATGACAGG + Intergenic
1096638990 12:52979330-52979352 AAATTTAACCTGTTCAAAACTGG + Intergenic
1097984989 12:65773433-65773455 ATTCTGAGCATGTTTAAAATAGG - Intergenic
1099436707 12:82654642-82654664 AAATTGATCAATTTTAAAATAGG + Intergenic
1100067747 12:90670593-90670615 AAATTCACCATGTTAAAAAATGG + Intergenic
1100238862 12:92689674-92689696 AAACTAAGCATGTTTTAAATTGG + Intergenic
1101466362 12:104954095-104954117 AAAGTGAGGATGTTAAAAAATGG - Intronic
1104216434 12:126738556-126738578 AAATTAAGACTGTTTAAAAATGG - Intergenic
1105765979 13:23560013-23560035 AAATTAAACATTTTTAAAAGGGG + Intergenic
1106674168 13:31940111-31940133 AAACTCAGCATGTATAAAACTGG - Intergenic
1107570446 13:41651954-41651976 AAATTCAGAATGTTTCACACTGG - Intronic
1108022767 13:46145602-46145624 AAATGGAGCATTTCTAAAAGAGG + Intronic
1109244119 13:59931817-59931839 TAACTGAACATGTTTTAAACTGG - Intronic
1109380775 13:61557178-61557200 AAATTTAGATTATTTAAAACTGG + Intergenic
1109440416 13:62364200-62364222 AAATTCAGAATGATTAACACGGG + Intergenic
1109488421 13:63059480-63059502 AAATTGATAAATTTTAAAACAGG - Intergenic
1109495791 13:63170130-63170152 AAATTGAAAGTGTCTAAAACAGG + Intergenic
1109609191 13:64740771-64740793 CAATTAAGCAACTTTAAAACTGG + Intergenic
1109778296 13:67073030-67073052 CAATTGAACATGTTTAAATGTGG - Intronic
1110089515 13:71427662-71427684 AAAATAAGAATGTTTAAAAATGG + Intergenic
1110116674 13:71826051-71826073 AAATTTTGCATCTTAAAAACTGG + Intronic
1111566123 13:90018525-90018547 AATTTGGGAATGTTTAAATCAGG - Intergenic
1112495698 13:99902465-99902487 AAAATCAGCATATTTTAAACTGG + Intergenic
1112664804 13:101557437-101557459 AACTTGACCATTTTTAATACAGG - Intronic
1112842454 13:103597773-103597795 AAATTAATAATGTTTAAAAATGG + Intergenic
1112882635 13:104126428-104126450 AAAATGAGAATGTTTAATAGAGG + Intergenic
1113869185 13:113547591-113547613 GAATTGAGCGTGTTTAAAGGGGG + Intronic
1114978020 14:28126105-28126127 TAATAGAGCATTTTAAAAACAGG - Intergenic
1115072840 14:29346817-29346839 AAATAGAGAATATTTAAAATGGG - Intergenic
1115734315 14:36307886-36307908 AAATTTAGAATTTTTAAAAAGGG - Intronic
1115791695 14:36886614-36886636 AAATGGAGCATGTCTAAAGGAGG + Intronic
1116100956 14:40435151-40435173 TAATCCAGCATCTTTAAAACTGG + Intergenic
1116536767 14:46041456-46041478 CAACAGAGCATGTTTAACACTGG - Intergenic
1118070345 14:62239939-62239961 AACATGAGAATGTTTAATACTGG + Intergenic
1119091992 14:71791622-71791644 ATGTTGAGCATTTTTAAAATAGG + Intergenic
1120015856 14:79472518-79472540 GAATTAAGCATGTTTGAAAAAGG + Intronic
1120025773 14:79582345-79582367 AAGTTGAGAATTTTTAAATCTGG - Intronic
1120317084 14:82908212-82908234 ATATTGAATATGTTTAAAACAGG + Intergenic
1122185149 14:99986724-99986746 CAATTCAGCATGTCTACAACTGG + Intronic
1123726409 15:23106965-23106987 AAATTGAGAATATTGAAAAAAGG - Intergenic
1124065981 15:26344248-26344270 AAATAAAGCAGGTTTAAAAATGG + Intergenic
1124351912 15:28962012-28962034 AAATTCATCATCTTCAAAACTGG - Intronic
1124605432 15:31166815-31166837 AAAATAAACATTTTTAAAACTGG - Intergenic
1126522255 15:49608233-49608255 ACATTTACCTTGTTTAAAACAGG + Intronic
1127039556 15:54959344-54959366 AACTTGCGCCTGTTTAAAACTGG + Intergenic
1127198577 15:56617656-56617678 ATTTTGAGCATGTTTAAAGTAGG - Intergenic
1127203828 15:56690514-56690536 ATATTGAGCATGTTTAACAGAGG + Intronic
1127338225 15:58012095-58012117 AGCTTGAGAGTGTTTAAAACAGG + Intronic
1127639175 15:60899244-60899266 ATATTGAGGGTGTTTGAAACTGG - Intronic
1128105251 15:65039590-65039612 ACATTCTGCATGTTTAAAAATGG - Intergenic
1129605618 15:77023642-77023664 AAATTCAGCGTGTCCAAAACCGG - Intronic
1129796680 15:78382913-78382935 TAATTGAGAATGTCTTAAACTGG + Intergenic
1130237786 15:82153804-82153826 CAATTTAGCATATTTAAAAGTGG - Intronic
1131784291 15:95894920-95894942 AAATTGAGGATCTGTAAATCAGG + Intergenic
1133386234 16:5372414-5372436 AAATTGTACATGTTTGAGACTGG - Intergenic
1135697907 16:24606344-24606366 AAATTGTGCTTGCTTAAACCAGG - Intergenic
1137842608 16:51653852-51653874 AATGTGAGCACCTTTAAAACAGG - Intergenic
1137876212 16:51999021-51999043 AAATTGAAGGTGTTTAAAAAAGG - Intergenic
1141338340 16:83178589-83178611 AAAGTGATCATTTTTAAAAATGG - Intronic
1149840096 17:59955204-59955226 AAATTGAGGTTTTTTGAAACTGG + Intronic
1150695403 17:67400744-67400766 AAAATGGGCATGTTAAAAAGAGG - Intronic
1153614221 18:6919876-6919898 CAATTTAGCACGTTTCAAACTGG + Intergenic
1154408944 18:14125018-14125040 AAATTTTGCAGGTTTAAAAAGGG + Intronic
1155164258 18:23219906-23219928 AAATTGAGATTTTTTAAAAATGG + Intronic
1158316543 18:56217188-56217210 AATTAGAGTATTTTTAAAACAGG + Intergenic
1159213150 18:65355972-65355994 AAATTGAACATATTTATAATAGG + Intergenic
1162508287 19:11101230-11101252 AAATGGAGCTTGTTAAAAACTGG - Intronic
1166493302 19:43278611-43278633 AAAGTGAGGATGTTAAAAAAAGG + Intergenic
1167014753 19:46833708-46833730 AAATTGGCCAGGTTTAAAACAGG + Intergenic
925391011 2:3494006-3494028 AATATAAGCATGTTTAATACTGG - Intergenic
925518544 2:4713222-4713244 AGAATGTGCATGTTAAAAACTGG - Intergenic
927078692 2:19606219-19606241 AGATTGAACATGTTTATTACAGG - Intergenic
928665032 2:33542404-33542426 AAAGTGGGCATGTTGAAAACAGG - Intronic
928675766 2:33649553-33649575 TAATTGAACATGATTTAAACAGG - Intergenic
929421185 2:41791445-41791467 AATTTGAGCATGTTTAAGTTAGG - Intergenic
931650187 2:64461388-64461410 AAATGTAGCATGTTATAAACTGG - Intergenic
931685856 2:64792176-64792198 AAATTGAGTATAAATAAAACTGG - Intergenic
932505941 2:72232301-72232323 AAACTGAGAATATTTAATACCGG + Intronic
933192167 2:79346866-79346888 AAAATAAGCATCTTTAAACCAGG - Intronic
935044361 2:99466878-99466900 AAAATGAGCCTCTTGAAAACAGG - Intronic
935096076 2:99945555-99945577 AAATTGAGCAAGTAGAAAGCAGG - Intronic
935096669 2:99951593-99951615 AAACTGACCATTTGTAAAACTGG - Intronic
935158213 2:100503354-100503376 AAAATGGGCATGTATAAAAATGG + Intergenic
937567814 2:123317118-123317140 ATGTTGACCATGTTTAAACCTGG + Intergenic
938044200 2:128102028-128102050 AAATTGATAATTGTTAAAACAGG - Intronic
938572126 2:132570382-132570404 AAAATAAGGATGATTAAAACAGG - Intronic
940245702 2:151613384-151613406 AAAATTAGCTTGTTTAGAACAGG + Intronic
940385148 2:153062791-153062813 ATATGGAGAATGTTTTAAACAGG - Intergenic
941749091 2:169116766-169116788 AAATTGAAGAAGTTTTAAACAGG + Intergenic
942657279 2:178227007-178227029 AAATTGATCATTTTTGAAACTGG + Intronic
942758223 2:179366681-179366703 AGATTTAGCATTGTTAAAACAGG - Intergenic
943799338 2:192038304-192038326 AAGTTCATCATCTTTAAAACTGG + Intronic
943844705 2:192630541-192630563 AAATTCAACATGTTCAAATCTGG - Intergenic
945626650 2:212216528-212216550 TAATTCATCATGTTAAAAACAGG - Intronic
945683426 2:212939835-212939857 AAATTGAGCAGCTTTAATATCGG - Intergenic
945956573 2:216091810-216091832 CAATTGAACAGGTTTAAAACTGG + Intronic
947945579 2:234099061-234099083 AGATTAAGCATGTTTAACTCAGG + Intergenic
1168748449 20:264984-265006 AGATTGAGCATATTTAAAGCTGG - Intergenic
1170437627 20:16346628-16346650 AACTTCAGCATCTTCAAAACAGG + Intronic
1170495274 20:16917559-16917581 CAATTTAGGATGTTTAAAATTGG - Intergenic
1171254452 20:23678734-23678756 ATATTGTGCATTTTTAAAATCGG + Intergenic
1173720918 20:45257305-45257327 AGATTGAGCTTTTCTAAAACAGG + Intergenic
1174370172 20:50081650-50081672 AAATTGAAGAAGTTTTAAACAGG - Exonic
1176942910 21:14945395-14945417 AAACATAGCATGTTTACAACAGG - Intergenic
1177572130 21:22900944-22900966 GAATTTTGTATGTTTAAAACAGG + Intergenic
1177902046 21:26928473-26928495 AAATTTAGCAATTTTAAAACTGG + Intronic
1178729559 21:35087365-35087387 AAATTGAGCTGGTTTCAAATTGG - Intronic
1178772523 21:35518923-35518945 AAATGGAGCATTTGTATAACTGG + Intronic
1179066764 21:38031886-38031908 AACCTGAGCATGTTTAAAGAAGG + Intronic
1182893689 22:33841075-33841097 AAAGTGAGCATGTTTAAGGCAGG + Intronic
1184328156 22:43807519-43807541 AAATAGCACGTGTTTAAAACTGG - Intronic
949752346 3:7368864-7368886 AAATTCAACATGTTTGTAACAGG - Intronic
949755556 3:7406573-7406595 ATATTGATAATGTTTGAAACTGG - Intronic
950876054 3:16274896-16274918 AAAATGAGCATTTTAAGAACAGG + Intronic
951081865 3:18460768-18460790 AAAATGTACATATTTAAAACAGG + Intergenic
951713462 3:25611050-25611072 AAACTCAGCATGTCTGAAACTGG - Intronic
951932763 3:27987283-27987305 AATTTGAGTATCTTTAAAATTGG - Intergenic
951934739 3:28009846-28009868 CAATAGAGAATGTTTAAAACTGG + Intergenic
952277957 3:31895665-31895687 AATGTGAACATCTTTAAAACAGG + Intronic
953021509 3:39117032-39117054 AAATTGAGAATGGTTGAGACAGG - Intronic
953672011 3:44970835-44970857 AAAATGACCATGTTTAAATTGGG - Intronic
954340561 3:49950242-49950264 AAATTAAGAGTGTTTAAAGCAGG + Intronic
954477377 3:50760574-50760596 GTTTTGAGCATGTTTAAAATAGG + Intronic
954600093 3:51860698-51860720 AAACTGTGTATCTTTAAAACTGG + Intergenic
955039829 3:55305142-55305164 AAATTGAGCATTTTCAGATCTGG - Intergenic
955821102 3:62896308-62896330 AAATTGAGGATAGCTAAAACAGG - Intergenic
955838134 3:63080528-63080550 TAAATGAGTATGTGTAAAACTGG + Intergenic
956596898 3:70977407-70977429 AAAATGAGCCTGTTTAAAGATGG - Intronic
956792536 3:72691197-72691219 AAAATGAGCATTTTCAAAAGAGG + Intergenic
957518433 3:81286900-81286922 AAATTAGGCCTGTTTAACACAGG - Intergenic
957780920 3:84816656-84816678 AAATTCAGCATTTTAAAAAATGG - Intergenic
959732441 3:109619262-109619284 AAATTGAACACATTTGAAACGGG + Intergenic
961242700 3:125426001-125426023 AGATTGTGCATGTATAAAGCTGG - Intergenic
963985116 3:151584080-151584102 AAATTGATCAATTTAAAAACTGG - Intergenic
963990666 3:151649726-151649748 AAATTCAACATGTCTGAAACAGG + Intergenic
965691590 3:171362843-171362865 TAATTGAGCATTTTTATAAGTGG - Intronic
966083582 3:176037793-176037815 AAATTGAGCATGTTCATATGTGG + Intergenic
966181341 3:177191582-177191604 AAATTAAGTATGGTTAAAAATGG + Intronic
966617038 3:181924773-181924795 AAAATCAGCATATTCAAAACTGG + Intergenic
967626041 3:191684993-191685015 AAATTGATCATCTCTAAAAGTGG - Intergenic
971824665 4:31605396-31605418 TAATTGAGCATGTCTAAACTAGG - Intergenic
972903416 4:43713803-43713825 AATTTGAGCATTTTTTAAAAAGG + Intergenic
973743815 4:53944272-53944294 GAATTGACCATCTTCAAAACAGG + Intronic
973793964 4:54404681-54404703 AAAAAGAGCATGTTTTAAACTGG - Intergenic
973915162 4:55626389-55626411 ATATTGACAATGTCTAAAACTGG - Intronic
974136784 4:57827874-57827896 AAAGTTAGAATGTTTAAAACAGG - Intergenic
974532966 4:63135101-63135123 AAATTGACTATGTATAAAAAAGG - Intergenic
974698519 4:65406771-65406793 AAAATTAACATGTTTAAAATTGG + Intronic
974777315 4:66501968-66501990 ACATTTAGCATTTTGAAAACTGG + Intergenic
978701839 4:111656316-111656338 TAATTGTGCACGTTTCAAACAGG + Intergenic
981270535 4:142843498-142843520 AACTTGAGATTATTTAAAACAGG + Intronic
981449559 4:144880472-144880494 TAATTGAACATGTTCAAAATGGG - Intergenic
981569766 4:146139092-146139114 AAATTTAACATGATCAAAACTGG + Intergenic
981895528 4:149795182-149795204 AAAGTGATCATGTTTAAACAGGG + Intergenic
982220808 4:153123714-153123736 ACATTGAACATGTTAAAGACAGG + Intergenic
983769303 4:171528930-171528952 CAGTTGAACATGTATAAAACTGG + Intergenic
983927460 4:173417270-173417292 AAATTGAGGATCTTTAGCACTGG + Intergenic
984684157 4:182647036-182647058 AACTTAAGCATGTTTACAAATGG - Intronic
985258802 4:188096011-188096033 AAATTCAGCATGTATAACAAAGG - Intronic
985360030 4:189164211-189164233 AAAATGGGCATGTATAAAACAGG - Intergenic
987454896 5:18131341-18131363 AAATTGCTGATGTTTTAAACTGG + Intergenic
987485575 5:18521534-18521556 AACTGGAGCAACTTTAAAACTGG - Intergenic
987514245 5:18885655-18885677 AAATTGAAGAAGTTTTAAACAGG - Intergenic
988106894 5:26761956-26761978 AAAGTGAGAATGATTATAACTGG - Intergenic
990199516 5:53355531-53355553 AAATTCATCATGTTTAGATCAGG - Intergenic
990727104 5:58768142-58768164 AAAGTCAGCATGTTCAAGACAGG - Intronic
991449335 5:66735111-66735133 AAACTGAGCTTTTTTAAAAAGGG + Intronic
992649161 5:78840639-78840661 AAATTGAGCATATTTAACTTTGG + Intronic
992861993 5:80920657-80920679 ATATTGAACATATTTTAAACAGG + Intergenic
994739363 5:103598793-103598815 AAATTAAACATGCCTAAAACTGG - Intergenic
995245882 5:109935040-109935062 AAACTGAGGATGTTTAAGCCAGG - Intergenic
995447026 5:112255846-112255868 AAATTCAACATGTTCAAAACGGG + Intronic
995657623 5:114444550-114444572 AATTTGAGAATGTTTGAAAGTGG + Intronic
997292731 5:132748927-132748949 AAATTGAGCCTTTTAAAAATGGG + Intronic
997409255 5:133678598-133678620 AAAATGAGCATGTCCAAAACTGG - Intergenic
998129041 5:139642034-139642056 AAATTGGGCATGCTTCAATCAGG - Intergenic
998632609 5:143916524-143916546 AAATGGAGTATGCTTAGAACTGG + Intergenic
999569603 5:152904638-152904660 ATATTCAGCATGTTTAAAAATGG - Intergenic
999878003 5:155829732-155829754 AAACCAAGAATGTTTAAAACAGG - Intergenic
1000492733 5:161934957-161934979 CAATTGAACATCTTTAAAATGGG - Intergenic
1000981585 5:167822296-167822318 AGTTTTTGCATGTTTAAAACAGG - Intronic
1003564283 6:7209352-7209374 AAAATGAGCATTTCTAAAATTGG + Intronic
1003767627 6:9258726-9258748 AAATTAAGCTTTTTTAAAACTGG - Intergenic
1003806780 6:9734520-9734542 AGAGTGAGCATGTTTACAAGGGG + Intronic
1003876030 6:10437850-10437872 AAATTACGTATGTTTAAAAAAGG + Intergenic
1004631282 6:17424098-17424120 AACTTGAAAATGTTTAAAATCGG + Intronic
1007491703 6:42228222-42228244 AAAATGACCACTTTTAAAACAGG + Exonic
1007768401 6:44175129-44175151 AAAGTGAGCACTTGTAAAACTGG + Intronic
1008049588 6:46886603-46886625 AAACTGAGGATATTTAAAACCGG - Intronic
1008089470 6:47278951-47278973 AAACTGAGCAGGTTTAAACGAGG + Intronic
1008426539 6:51364882-51364904 AATTTGAGAAAGTTTAATACAGG + Intergenic
1008559592 6:52710803-52710825 ACATTGAGCATCATTAAAAGGGG + Intergenic
1009308705 6:62122782-62122804 AAACTGGCCTTGTTTAAAACTGG - Intronic
1009372237 6:62920230-62920252 AAATTGAGATTATTTGAAACTGG + Intergenic
1009475292 6:64083628-64083650 GAAGGGAACATGTTTAAAACTGG + Intronic
1009573186 6:65416014-65416036 AAATTGAGAATGTGAAAAAGTGG + Intronic
1009790622 6:68397190-68397212 AAATTGAGCATCATCAAAATTGG + Intergenic
1010059198 6:71603088-71603110 AAAATGTTCATGTTTAAAAAAGG + Intergenic
1010115535 6:72303622-72303644 AAATTAAGAAAGTATAAAACTGG - Intronic
1010461912 6:76123366-76123388 AAATTCAGCATTTTTTAGACAGG + Intergenic
1012659724 6:101872915-101872937 ACATTGAACATATTTAAAGCAGG + Intronic
1012956653 6:105577829-105577851 CAAATGAGCATATGTAAAACTGG - Intergenic
1013678279 6:112491648-112491670 AAAATAAGCATGCTTAAAATTGG - Intergenic
1014260478 6:119210946-119210968 ATATTGAGTCTTTTTAAAACTGG + Intronic
1014953515 6:127587901-127587923 AAATTGACAGGGTTTAAAACAGG + Intronic
1016795393 6:148112100-148112122 AAAATGATCATCTTTAATACAGG + Intergenic
1017105743 6:150886019-150886041 AAATTGAGCATGTTTAAAACAGG - Intronic
1018089599 6:160334168-160334190 AATTTCAACATGTCTAAAACTGG + Intergenic
1018484679 6:164228668-164228690 AAAATATGCATGTATAAAACAGG - Intergenic
1020170138 7:5838704-5838726 AAATTGAAGATGTTTAAATGGGG + Intergenic
1020463187 7:8446615-8446637 AAATTGTGCCTGTGGAAAACAGG - Intronic
1020545828 7:9528970-9528992 ATCTTGAGCATGTTTAAGATTGG - Intergenic
1021707040 7:23378127-23378149 AAATTAAAAATGTTTAAAACAGG + Intronic
1022165568 7:27757212-27757234 AAATTGGAGATGTTTAAAACAGG - Intronic
1022262741 7:28722124-28722146 TAAATCAGCCTGTTTAAAACTGG + Intronic
1023544165 7:41299678-41299700 AACTTGGGCATGATTAAAATAGG + Intergenic
1023772303 7:43568940-43568962 AATTTGAGCATGTATAAAAATGG + Intergenic
1024886644 7:54149534-54149556 AAATTTAACATGTCTGAAACTGG - Intergenic
1024907881 7:54409385-54409407 AAATTGAGCAATTTTGAAAATGG - Intergenic
1027461159 7:78455512-78455534 ATAATGGGCATATTTAAAACTGG - Intronic
1028006494 7:85576068-85576090 AAATTGAGGAAGTTTAGTACAGG + Intergenic
1028125828 7:87112205-87112227 AAATTGAGAATTTTTAAGAATGG + Intergenic
1028255276 7:88588215-88588237 GAATAAGGCATGTTTAAAACTGG - Intergenic
1031663411 7:124455393-124455415 TAATTTAGCATGTATAACACTGG + Intergenic
1032889127 7:136174986-136175008 CAATTGATCATTTTTAAAACAGG + Intergenic
1033592656 7:142825523-142825545 AAATTTCGAATTTTTAAAACTGG - Intergenic
1034325796 7:150230971-150230993 AAATTGATAATATCTAAAACAGG - Intergenic
1034356552 7:150454829-150454851 AATTAGAACATATTTAAAACTGG + Intronic
1037237116 8:16733293-16733315 AAATTAACAAAGTTTAAAACTGG + Intergenic
1037327493 8:17708262-17708284 AAAATGACCCAGTTTAAAACTGG + Intronic
1038244469 8:25842490-25842512 AAATTAAGCATGTTTAGCCCTGG - Exonic
1038876420 8:31555304-31555326 TCATTGAGCATATTTAAGACAGG - Intergenic
1039226253 8:35391759-35391781 AAAGTGAGGATGATTAGAACTGG + Intronic
1039655320 8:39398734-39398756 AAATTTATCATTTTTAAAAAGGG + Intergenic
1041643259 8:60225662-60225684 AAATTGATCTTTCTTAAAACTGG + Intronic
1042877860 8:73456302-73456324 AAATAGGGCCTCTTTAAAACAGG + Intronic
1043059756 8:75485620-75485642 AAATTAGGTATCTTTAAAACTGG - Intronic
1043308381 8:78825845-78825867 AAATTGAATATGTCTAAAAGGGG - Intergenic
1043709697 8:83400706-83400728 AATTTGATCATCTTTAAAATAGG + Intergenic
1044046844 8:87446203-87446225 AACTTCAGCATTTTTAGAACCGG - Intronic
1045243664 8:100424251-100424273 AATTTGATCATGTTACAAACTGG - Intergenic
1045755841 8:105540626-105540648 GGACTGAGCATTTTTAAAACAGG - Intronic
1046724330 8:117658018-117658040 AAAATGAGAATGTTTAACAAAGG + Intergenic
1047606034 8:126475463-126475485 AAATTTAGCATTTTGAAAACAGG + Intergenic
1048335521 8:133499462-133499484 AAATTTAGCATTTTTACAACAGG - Intronic
1048625745 8:136183211-136183233 AGCTTGATCATCTTTAAAACAGG - Intergenic
1050332288 9:4557483-4557505 AAATTGAGATTAATTAAAACTGG + Intronic
1050568012 9:6906999-6907021 TAAATGACCTTGTTTAAAACTGG - Intronic
1051400136 9:16672195-16672217 AAATTGAAAATGTTTAACATTGG + Intronic
1052695317 9:31870088-31870110 ATGTTGAGCATGCTTAGAACAGG - Intergenic
1053560504 9:39188856-39188878 AAATTGAGGATAATTAAAGCTGG + Intronic
1053672972 9:40388486-40388508 AAATAGAACATGCTTAAAAATGG - Intergenic
1053824604 9:42009097-42009119 AAATTGAGGATAATTAAAGCTGG + Intronic
1054136615 9:61430099-61430121 AAATTGAGGATAATTAAAGCTGG - Intergenic
1054511653 9:65987797-65987819 AAATAGAACATGCTTAAAAATGG + Intergenic
1054605967 9:67178266-67178288 AAATTGAGGATAATTAAAGCTGG - Intergenic
1055011102 9:71566411-71566433 AAATAAAGCAAGATTAAAACTGG + Intergenic
1055545370 9:77366208-77366230 GTTTTGAGCATGTTTAAGACAGG - Intronic
1056217822 9:84421723-84421745 AAGTTGACCATGTGGAAAACTGG + Intergenic
1056292889 9:85161374-85161396 AAATTGAAGAAGTTTTAAACAGG + Intergenic
1056293050 9:85163229-85163251 AAATTGAAGAAGTTTTAAACAGG + Intergenic
1057464698 9:95302148-95302170 AAATTAAACATGTTTAATTCAGG - Intronic
1057473012 9:95374721-95374743 AAATTGAAAATGTTTAAAGGAGG + Intergenic
1058177400 9:101752937-101752959 TAAATAAGCATGTTAAAAACAGG + Intergenic
1059125156 9:111677513-111677535 AAGTTAAGCTTGTTTAAAAAAGG + Intergenic
1059200315 9:112408885-112408907 AAATTGATTATTTTGAAAACAGG + Exonic
1060296363 9:122346362-122346384 AAATTGGGGCTGTTTTAAACAGG - Intergenic
1185934762 X:4243857-4243879 AATTTTAGCTTCTTTAAAACAGG + Intergenic
1188183037 X:27078859-27078881 AATTAGAGCATCTATAAAACAGG - Intergenic
1189205705 X:39236994-39237016 AAATTGAGAATATGTAAATCGGG - Intergenic
1192881739 X:75292291-75292313 AAATTGAGCCTGTTTTAAAGGGG + Intronic
1193523037 X:82553585-82553607 ATTGTGAGCAGGTTTAAAACAGG + Intergenic
1195952506 X:110290653-110290675 AAATTGTCCATTTTTAACACTGG - Intronic
1196124861 X:112086303-112086325 AAATTGAGCAATTTGAAAGCAGG + Intergenic
1197375842 X:125681289-125681311 AAATTTATAATCTTTAAAACTGG + Intergenic
1198140691 X:133799629-133799651 AAATTTATCATGTAAAAAACAGG - Intronic
1198372125 X:136000325-136000347 TAGTTTAGCATTTTTAAAACTGG + Intronic
1199900881 X:152170689-152170711 AAACTGAGGCTGTGTAAAACAGG + Intronic
1201668983 Y:16493898-16493920 CAATTTAGCATGTTTATGACAGG - Intergenic