ID: 1017107790

View in Genome Browser
Species Human (GRCh38)
Location 6:150904414-150904436
Sequence CTGAATTCACTAGGAGACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 130}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017107784_1017107790 23 Left 1017107784 6:150904368-150904390 CCATCAGTCGCCCTCTTGCTGCC 0: 1
1: 0
2: 0
3: 15
4: 199
Right 1017107790 6:150904414-150904436 CTGAATTCACTAGGAGACACAGG 0: 1
1: 0
2: 1
3: 19
4: 130
1017107786_1017107790 13 Left 1017107786 6:150904378-150904400 CCCTCTTGCTGCCTAGGTTCACT 0: 1
1: 0
2: 0
3: 16
4: 160
Right 1017107790 6:150904414-150904436 CTGAATTCACTAGGAGACACAGG 0: 1
1: 0
2: 1
3: 19
4: 130
1017107787_1017107790 12 Left 1017107787 6:150904379-150904401 CCTCTTGCTGCCTAGGTTCACTA 0: 1
1: 0
2: 0
3: 2
4: 85
Right 1017107790 6:150904414-150904436 CTGAATTCACTAGGAGACACAGG 0: 1
1: 0
2: 1
3: 19
4: 130
1017107788_1017107790 2 Left 1017107788 6:150904389-150904411 CCTAGGTTCACTAGAATCTCTAA 0: 1
1: 0
2: 0
3: 14
4: 124
Right 1017107790 6:150904414-150904436 CTGAATTCACTAGGAGACACAGG 0: 1
1: 0
2: 1
3: 19
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017107790 Original CRISPR CTGAATTCACTAGGAGACAC AGG Intronic
903325522 1:22566724-22566746 CTGAATTCCCAAGGGGACCCAGG + Intronic
905942227 1:41873288-41873310 CAGAATTTTCTAGGAGAGACAGG + Intronic
906462534 1:46047008-46047030 CTCAATTCAGTAGGTCACACAGG - Intronic
908214863 1:61940940-61940962 CTGAGATCACTAGGAGAGAAAGG + Intronic
910118037 1:83754157-83754179 TTGAATTCCCTAGAAGTCACAGG + Intergenic
910289422 1:85586154-85586176 ATGAATTCACTAGGTGACTCTGG + Intergenic
911179974 1:94851714-94851736 CTGAAGCCAGTGGGAGACACAGG + Intronic
911456664 1:98133046-98133068 CTGAATTCAAAAGGAGACCTGGG - Intergenic
911562667 1:99425527-99425549 CTAAATTAACTTGAAGACACAGG - Intergenic
914417774 1:147499755-147499777 CTGAGTTCAGGAGGAGACCCTGG - Intergenic
915553113 1:156646569-156646591 CTGAATTGACTGGGAGACTTTGG + Intronic
915971673 1:160359501-160359523 CTTTATTCACTCTGAGACACTGG + Intergenic
916214907 1:162386027-162386049 CTGTATTCAGTATCAGACACAGG - Intronic
917723473 1:177808563-177808585 ATGAACTCAGTGGGAGACACTGG + Intergenic
917891833 1:179447128-179447150 CTGTATTCAATAGGAGAGAAGGG - Intronic
918025915 1:180745855-180745877 ATGAATTCACTGGGAGAGACAGG + Intronic
919497386 1:198290610-198290632 CATAATTCACTAGGGAACACAGG - Intronic
920655398 1:207870510-207870532 CTCACTGGACTAGGAGACACTGG - Intergenic
1065359897 10:24879655-24879677 CTGAATTCTAAAGAAGACACTGG + Intronic
1065480310 10:26186633-26186655 CTGAATTTACTAGCAGATAAGGG - Intronic
1065962270 10:30743401-30743423 CTGTATTCACTAGGAGGGCCAGG + Intergenic
1069867990 10:71515767-71515789 CTGAATACACTACAAGCCACAGG - Intronic
1070937810 10:80315171-80315193 CTGCATTCAGTAGGAGAGACAGG - Intergenic
1071057734 10:81530565-81530587 CTGAATACAGTTGGACACACTGG - Intergenic
1073262600 10:102201711-102201733 CTTAATTCCCTAGGAGAAAGGGG - Intergenic
1074156495 10:110804815-110804837 ATGAAGTGACTGGGAGACACTGG - Intronic
1076710879 10:132333464-132333486 CTGGAGTCACCTGGAGACACGGG - Exonic
1079764384 11:24373054-24373076 CATAATTAACTAGGAGACAGTGG - Intergenic
1083164313 11:60874281-60874303 CTGATTTCACTTGGAAGCACTGG + Intronic
1084862068 11:72025568-72025590 CTGAATTCTCTAGGCTACAGTGG + Intronic
1085115032 11:73923849-73923871 CTGTATACACTAGGAGAAAGAGG - Intronic
1090987356 11:131780501-131780523 CTGAGATCACTAGGAGAATCTGG + Intronic
1095605835 12:44066420-44066442 CAGAATTCAACAGGTGACACAGG - Intronic
1097340560 12:58432915-58432937 CCAAATTGTCTAGGAGACACTGG - Intergenic
1100713817 12:97284915-97284937 CTGAATTCAAAAATAGACACAGG + Intergenic
1102774820 12:115509234-115509256 CTGAACTCACCAGGTGCCACAGG - Intergenic
1102940011 12:116932213-116932235 CTGTATTCTCTAGGAGACACTGG + Intronic
1105839159 13:24238549-24238571 GGGAATTCACTGGGTGACACAGG + Intronic
1108857234 13:54809598-54809620 CAGAACTCACTAGAAGACACAGG + Intergenic
1121800596 14:96770908-96770930 CTGAAAGCACCAGGAGACAGGGG - Intergenic
1123901379 15:24880568-24880590 CTATATTCAGTAGGAGAGACAGG + Intronic
1124834865 15:33186900-33186922 CTGCATTGACTAAGAGTCACTGG - Intronic
1125549667 15:40536112-40536134 CCCAAGTCACCAGGAGACACAGG + Intronic
1125895722 15:43300352-43300374 CTTAATTAAGTAGGTGACACTGG - Intronic
1126270903 15:46815815-46815837 CTGAATACACTAGAAGGCAAAGG + Intergenic
1126458367 15:48889317-48889339 GTGGATTCTCTAGGTGACACTGG + Intronic
1127587329 15:60391157-60391179 CTTAATTCACTGGGTGACCCTGG - Intronic
1131819378 15:96256732-96256754 CTGATTTCACTTGAAGAGACTGG - Intergenic
1135279004 16:21137797-21137819 CTGAAGTCACTAGGTTCCACTGG - Intronic
1135969385 16:27061289-27061311 CTGAGTGCATTAGGAGCCACGGG - Intergenic
1137961116 16:52883217-52883239 CTGACTTCAGGAGCAGACACAGG - Intergenic
1138789120 16:59881499-59881521 CTGGATTCATTAGGAAGCACAGG + Intergenic
1140497493 16:75402025-75402047 CTATATTCACTAGGAAACACTGG + Intronic
1151398918 17:73843027-73843049 CTAAATCCCCCAGGAGACACGGG + Intergenic
1153185627 18:2482929-2482951 CTGAATTTACAAGGAGACTGTGG + Intergenic
1157554932 18:48607249-48607271 CTGAATTCTCTACGAACCACAGG - Intronic
1158149987 18:54357534-54357556 CTGAACTCACTTGGAAAAACTGG + Intronic
1168368922 19:55814782-55814804 CTGGATTATCTAGGACACACGGG + Intronic
925872471 2:8283123-8283145 CTGATTTCATTAGGAGATAAGGG - Intergenic
926216146 2:10906661-10906683 CTGAATACACTAAAAGCCACTGG + Intergenic
929985563 2:46728296-46728318 CTATATTCAGTAGGAGAGACAGG + Intronic
931803945 2:65786486-65786508 ATAAATTCACTTGAAGACACTGG - Intergenic
935527329 2:104186880-104186902 CTGTATTCAATAGGTGAGACAGG + Intergenic
938238509 2:129724827-129724849 CTGAATTCACTGTGAGACGCTGG - Intergenic
939268356 2:139905188-139905210 CTGAATTAAGTATGAGCCACTGG - Intergenic
942483527 2:176415517-176415539 TTGAACTCACCAGGAGACCCAGG + Intergenic
1169120431 20:3092765-3092787 GTGAAGTCACCAGGAGAGACAGG + Intergenic
1169463697 20:5819160-5819182 CTGAATTAAGAAGTAGACACTGG - Intronic
1169998169 20:11582878-11582900 CTGGACTCACTGGCAGACACAGG - Intergenic
1170408551 20:16064827-16064849 CTGAATTTCCTGGGAGACATAGG - Intergenic
1170535732 20:17338809-17338831 CTGGAATGATTAGGAGACACTGG + Intronic
1181053302 22:20247672-20247694 CTCACTTCCCTAGGAGACTCAGG - Intronic
1183096067 22:35553047-35553069 CTGAATTTGCTAGGGGACAAAGG - Exonic
1184517828 22:44973624-44973646 CAGTATTCACTTGGAGACCCTGG - Intronic
1184818075 22:46887222-46887244 CTGAATTTCCCAGGAGACAAAGG - Intronic
954361670 3:50125596-50125618 CTGACTTCACTGGGGGACAATGG + Intergenic
957156737 3:76553048-76553070 ATGAATTCAATAGGAGAGATAGG + Intronic
959900248 3:111652865-111652887 CTAAATTCACTAACAGAGACAGG - Intronic
960363250 3:116739879-116739901 TTGAATTAACCAGGAAACACAGG + Intronic
962453006 3:135537407-135537429 CTGAAACCACTCAGAGACACTGG - Intergenic
965326392 3:167309622-167309644 CTGACTGCACTTGGAGCCACTGG + Intronic
969403564 4:6973504-6973526 CTGCATTCATTGGGTGACACCGG - Intronic
978989772 4:115066134-115066156 CTGATTTCAGTAGTAGAGACAGG - Intronic
980344720 4:131598540-131598562 CTGAATTCACTAAAAGCCACCGG - Intergenic
981559228 4:146028919-146028941 CTGCATGCACTATGAGAAACTGG + Intergenic
982402949 4:154988588-154988610 CTGGATTCATTATGAGGCACTGG + Intergenic
983689619 4:170452561-170452583 GTGAACTCACTAGGAGTTACTGG + Intergenic
984857259 4:184205811-184205833 CTGATTTCACTGTGAGACAGAGG + Intronic
985292003 4:188395595-188395617 CTGAATTCACCATGGAACACGGG - Intergenic
985602406 5:842132-842154 ATGAATTCACACGGAGACACTGG + Intronic
986427449 5:7648558-7648580 CTTAAATCATTAGGAGACCCTGG - Intronic
987664065 5:20913310-20913332 CTGAATTCACTAGTGGGCACTGG - Intergenic
987691667 5:21274847-21274869 CTGAATACACTAACAGACAATGG - Intergenic
988372769 5:30392871-30392893 CTAAATTCACACAGAGACACAGG + Intergenic
988758622 5:34288881-34288903 CTGAATTCACTAGTGGGCACTGG + Intergenic
991748710 5:69775290-69775312 CTGAATACACTAACAGACAATGG + Intergenic
991800288 5:70355102-70355124 CTGAATACACTAACAGACAATGG + Intergenic
991828312 5:70654939-70654961 CTGAATACACTAACAGACAATGG - Intergenic
991892646 5:71354542-71354564 CTGAATACACTAACAGACAATGG + Intergenic
992666553 5:79015167-79015189 GTGGATTAACTAGGAAACACAGG - Intronic
994448397 5:99907942-99907964 CTGCATTCACTGGGAGATACAGG - Intergenic
999827425 5:155287391-155287413 CTGAATTCACTAGAAGCCAGAGG + Intergenic
999935624 5:156482943-156482965 CTGAATATACTATGATACACAGG - Intronic
1004853335 6:19723748-19723770 CTGACATCACCAGGAGACAGAGG + Intergenic
1007193722 6:40041228-40041250 CTGAGTTCACTAAAAGCCACAGG - Intergenic
1007321369 6:41030916-41030938 CTGAAGTCACAGGGAGACAGTGG - Intronic
1007850434 6:44797729-44797751 GTGAAGTCACTGGGAGACCCAGG - Intergenic
1008563512 6:52745001-52745023 CTGATCTCACTTGGAGACACAGG - Intergenic
1008564797 6:52756646-52756668 CTGATCTCACTTGGAGACACAGG - Intronic
1008569129 6:52797972-52797994 CTGATCTCACTTGGAGACACAGG - Intronic
1008575948 6:52860310-52860332 CTGATCTCACCTGGAGACACAGG - Intronic
1013290968 6:108718601-108718623 GGGTATTCACTAGGAGCCACTGG - Intergenic
1013391386 6:109689588-109689610 CTGAATTCACTAGGGAATACTGG - Intronic
1014704052 6:124725029-124725051 CGGAATTCCCTAGTAGACACTGG - Intronic
1015605710 6:134952947-134952969 CTGCATTCAGCAGGACACACTGG - Intergenic
1017107790 6:150904414-150904436 CTGAATTCACTAGGAGACACAGG + Intronic
1019140967 6:169942349-169942371 CAGAAACCAGTAGGAGACACAGG + Intergenic
1020086982 7:5315847-5315869 CTGAAGTCATTTGGAGCCACAGG - Intronic
1021311036 7:19096326-19096348 CTGAAATCACTAGCACAAACAGG + Intronic
1024603397 7:51006528-51006550 GTGAATTCAACAGGAAACACTGG + Intergenic
1025207327 7:57001306-57001328 CTGAAGTCATTTGGAGCCACAGG + Intergenic
1025664610 7:63575580-63575602 CTGAAGTCATTTGGAGCCACAGG - Intergenic
1027358969 7:77388633-77388655 GTGAAGTCACTGAGAGACACTGG - Intronic
1031290029 7:119922675-119922697 TTGAATTCTCTAAGAGACAGTGG + Intergenic
1037121910 8:15298721-15298743 CTACATTCAGTAGGAGAAACAGG + Intergenic
1038934271 8:32231075-32231097 ATGAATTCACTAGGAGAAATAGG + Intronic
1039339400 8:36630375-36630397 CTGAATTAACTTGGTCACACAGG - Intergenic
1040875922 8:52152125-52152147 CTGACTTCACTGGGAGAGAGCGG + Intronic
1041127820 8:54662865-54662887 CTGCATTCAGTAGGAGAGACTGG + Intergenic
1041345092 8:56888834-56888856 CTGAATTTACTATGAGAAATTGG + Intergenic
1042179583 8:66072950-66072972 CTGAATTCACTATGAGTGAATGG - Intronic
1042702986 8:71637155-71637177 CTGAAATCACTTGGAGAGATAGG + Intergenic
1043284674 8:78514512-78514534 ATGATGTCAATAGGAGACACTGG + Intergenic
1043405699 8:79930219-79930241 CTTAATTAACTAGGCAACACAGG + Intronic
1043620227 8:82181393-82181415 CTGAATTTACTAGGACAGAAGGG + Intergenic
1044890338 8:96828436-96828458 GCCAATTGACTAGGAGACACTGG - Intronic
1046174163 8:110553149-110553171 CAGAATGCAGTAGGAGACAAAGG - Intergenic
1050532494 9:6602785-6602807 CTGAACTTCTTAGGAGACACAGG + Intronic
1055744466 9:79427379-79427401 CTGATTTCAGTGGGAGAGACAGG + Intergenic
1059255595 9:112927995-112928017 GTAAATTCACTAGAAGAAACTGG - Intergenic
1060126384 9:121051681-121051703 CTGAATTCACTAGGGAAAAAAGG + Intergenic
1060208529 9:121696798-121696820 CTGAGTTCTCTGGGGGACACAGG + Intronic
1060269464 9:122130658-122130680 CTGAGTGCACTGGGAGAGACTGG - Intergenic
1186270935 X:7887230-7887252 ATGAATTTACTAGGAAGCACTGG + Intergenic
1186819400 X:13271569-13271591 CTGATTTCACTAAGTGAAACAGG + Intergenic
1187799729 X:23047931-23047953 ATGAATTCCTTAGGTGACACTGG + Intergenic
1189102092 X:38201443-38201465 CTGCATTCAGTAGGAAAGACAGG - Intronic
1193101300 X:77615872-77615894 CTGATTTAATTAGGAGATACAGG - Intronic
1195791721 X:108595496-108595518 ATGATTTCACTAGGTGACAAAGG + Exonic
1198789401 X:140327177-140327199 CTGAATTAGATAGGAGTCACTGG + Intergenic
1199194915 X:145016938-145016960 CTGAATTCACAATGATAAACTGG + Intergenic