ID: 1017108654

View in Genome Browser
Species Human (GRCh38)
Location 6:150912000-150912022
Sequence ATGCACCTCCTCCTCTGATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 164}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017108654_1017108655 7 Left 1017108654 6:150912000-150912022 CCATATCAGAGGAGGAGGTGCAT 0: 1
1: 0
2: 0
3: 17
4: 164
Right 1017108655 6:150912030-150912052 ACTTTTAAAAACCAGATCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017108654 Original CRISPR ATGCACCTCCTCCTCTGATA TGG (reversed) Intronic
900538087 1:3188799-3188821 AGCCACCACCTCCTCTGAGAAGG + Intronic
900816577 1:4851765-4851787 ATGCCCCTCCTCATGTCATAAGG - Intergenic
901542263 1:9926381-9926403 ATGCAACTCCACCACTGAAATGG - Intronic
902626148 1:17677559-17677581 ATGGACCTGCCTCTCTGATATGG + Intronic
903666160 1:25008947-25008969 GCCCACCTCCTCCTCTGATGAGG + Intergenic
907946418 1:59140208-59140230 AGGCACCTCTTCCTCTGTTAGGG + Intergenic
908125963 1:61030597-61030619 ATGCACCACCTCCTTTAAGAAGG - Intronic
910289829 1:85589081-85589103 AGGCTCCTCTTCCTCTGAAAAGG + Intergenic
913999864 1:143684344-143684366 ATGCCCTTCCTCTTCTTATATGG - Intergenic
914195044 1:145443149-145443171 ATGCCCTTCCTCTTCTTATATGG - Intergenic
914375567 1:147070857-147070879 ATGCCCTTCCTCCTCCTATATGG + Intergenic
914476315 1:148025726-148025748 ATGCCCTTCCTCTTCTTATATGG - Intergenic
914503909 1:148272064-148272086 ATGCCCTTCCTCTTCTTATATGG + Intergenic
916091232 1:161309293-161309315 AGGCACCTCCTGCACTGCTAGGG + Intronic
916739431 1:167635445-167635467 ATTCACCCCCTCCTGTGATAGGG - Intronic
917217122 1:172690162-172690184 ATTAAACTCCTCCTCTGCTAAGG + Intergenic
918850188 1:189678219-189678241 ATGCACCGCTGCCTCTCATAGGG - Intergenic
920683961 1:208095080-208095102 AATCACTGCCTCCTCTGATATGG + Intronic
922299786 1:224287928-224287950 TTGCATCTGCTCCTCTGAGAGGG + Exonic
922802969 1:228372431-228372453 CTGCTCCTCCTCCTCTGACTGGG - Exonic
923234289 1:232017648-232017670 ATGAACCTCCACCTTGGATACGG - Intronic
924136072 1:240968188-240968210 ATTCACCTCTTCCTCTGCTGGGG - Intronic
1064017634 10:11784936-11784958 ATGCTCTTCCTCTTCTTATAGGG + Intergenic
1064658982 10:17586901-17586923 ATGGACTTCCTCCTCAGCTAGGG + Intergenic
1066547063 10:36511118-36511140 CTGCATCTCCTCTTCTTATAAGG - Intergenic
1067497526 10:46773805-46773827 ATGCATGTCCTCCCCTGAGAGGG + Intergenic
1067597125 10:47566610-47566632 ATGCATGTCCTCCCCTGAGAGGG - Intergenic
1067778026 10:49177005-49177027 CTGCACCTCCCCCTCTGGAAGGG - Intronic
1070617046 10:77977311-77977333 GAGCAGCTTCTCCTCTGATAGGG - Exonic
1071564149 10:86662966-86662988 CTCCACGTCCTCCTCTGAAAGGG + Intronic
1073173690 10:101536138-101536160 AAGCACCTCCCCCTCTGCCACGG - Intronic
1075461465 10:122619176-122619198 ATGCCCCTCCCTCTGTGATAGGG + Intronic
1076282521 10:129260635-129260657 CTGCACCTTCCCCTCTGATGAGG - Intergenic
1076605144 10:131684499-131684521 ATGCACCTTATACTCTGAAAAGG - Intergenic
1077466432 11:2735814-2735836 AGTCACCTTCTCCTCTCATAAGG + Intronic
1079771110 11:24461024-24461046 TTGCTCTTCCTCCTCTAATAAGG + Intergenic
1084267491 11:68012481-68012503 ATGCACCTCAACCTGTGATGGGG + Intronic
1084937556 11:72595239-72595261 ACGCACCTCCTTCTCTGCTGAGG - Intronic
1084995131 11:72969216-72969238 ATGCAGCTCCGTCTCTCATAAGG - Intronic
1087549117 11:99624491-99624513 ACCCACCACCTCATCTGATAAGG - Intronic
1088278457 11:108113808-108113830 ATGCTTCTCCTGCTCTGATAAGG - Intergenic
1090719762 11:129460426-129460448 GTGCCCCTCCTGCTCTGATGTGG - Intergenic
1090863372 11:130673754-130673776 ATGCCCCTCCTGCTGTGGTAGGG + Intronic
1092038038 12:5357993-5358015 AAGCAACTCCTCCTCTGTTCAGG + Intergenic
1092878666 12:12870788-12870810 AAACATCTCCTCCTCTGAGAAGG - Intergenic
1096553693 12:52390584-52390606 AAGCACCCCCTCCTCTGCTCAGG + Intergenic
1096899884 12:54866024-54866046 ATGTCCCTCCTCATTTGATATGG + Intergenic
1098638697 12:72815019-72815041 ATGCACTTCCTCCTCAGCCAGGG - Intergenic
1100333256 12:93605584-93605606 ATGCACCTCCTCCGCCAATCAGG + Intergenic
1103981568 12:124740146-124740168 ATGCTCCTCTTTCACTGATAAGG + Intergenic
1105587945 13:21761868-21761890 ATGCATCCCCTGTTCTGATAAGG + Intergenic
1106764965 13:32904406-32904428 ATGCATCTCCTGCTTTGATAAGG + Intergenic
1107545062 13:41427464-41427486 GTGCACCTCCTGCTCTATTATGG - Intergenic
1113158363 13:107351439-107351461 ACGCATCTCCTGCTTTGATAAGG + Intronic
1115314024 14:32007602-32007624 ATTAATCTCCTCCTCTGATGAGG + Intronic
1116456293 14:45124204-45124226 ATGCACCTGCTCTACTGAGAAGG - Intronic
1118113613 14:62750143-62750165 CTTCACCTCCTCCTCTAGTAAGG - Intronic
1119047972 14:71337706-71337728 ATCCATCTCAGCCTCTGATACGG - Intronic
1120718049 14:87861347-87861369 ATTGTCCTCCTGCTCTGATAGGG - Intronic
1121473202 14:94173252-94173274 ATGCACCCTCTCCTCTATTAAGG - Intronic
1123772182 15:23539839-23539861 AGGCAGCTGCTCATCTGATATGG + Intergenic
1124570502 15:30858667-30858689 AGGCACCTGTTCATCTGATATGG + Intergenic
1124870413 15:33536041-33536063 ATGCACCTCCAACTCAGATGAGG + Intronic
1125782792 15:42285432-42285454 ATGCATTTCCTCCTATGATCTGG - Intronic
1125920671 15:43523719-43523741 ATGGATCTCCTCATCTGAGATGG - Exonic
1129814607 15:78540665-78540687 CTGCACCGCCTCCTCTGTGACGG + Intronic
1132630150 16:913375-913397 ATGCAGCTTCTCCGCTGATTGGG - Intronic
1134833849 16:17345344-17345366 ATGTTCCTCCTCCTCTGTTTAGG - Intronic
1136008423 16:27346843-27346865 ATGCCGCTCCTCCTCTGTAAAGG + Intronic
1137745608 16:50818063-50818085 CTCCTCCTCCTCCTCTGAAACGG + Intergenic
1137862288 16:51858346-51858368 ATGCACCTCCTCTTCAGCTTGGG + Intergenic
1143158631 17:4854415-4854437 ATTCCCCTCCTCCTCTCAAAGGG - Intronic
1145736230 17:27233659-27233681 ACCAACCTTCTCCTCTGATATGG - Intergenic
1153363962 18:4232733-4232755 ATGCACTAGCTCCTCTCATATGG + Intronic
1153827862 18:8893390-8893412 CTTCATCTCCTCCTCTTATAAGG + Intergenic
1155390041 18:25325694-25325716 TTCCACCTCATCCTCTGAAAAGG + Intronic
1158730613 18:60018464-60018486 AAGCACCTCATCCCCAGATATGG + Intergenic
1158864392 18:61624194-61624216 ATGCACCTCTGCCTCTTATTAGG + Intergenic
1159076470 18:63686998-63687020 ATGCATCTCCTGCTTTGATAAGG + Intronic
1159743426 18:72201617-72201639 ATGCACCTCCTGATCTGACATGG + Intergenic
1159950680 18:74480500-74480522 GTGCCCCTCCTCTTCTTATAAGG - Intergenic
1164218384 19:23171637-23171659 ATGCACCTCTGCCTCTCATTAGG + Intergenic
1166238476 19:41473472-41473494 ACGTACATCCTCCTGTGATATGG - Intergenic
925560010 2:5181317-5181339 TTGCATCTCCATCTCTGATATGG - Intergenic
925844257 2:8020985-8021007 ATGCCCCTCCTCACCTGATGAGG - Intergenic
930818234 2:55620364-55620386 ATGCCCCTGCTCATCTGACAGGG - Intergenic
933128120 2:78636437-78636459 ATGAACATCCTCCTCTCTTACGG + Intergenic
941488435 2:166111927-166111949 AAGCAACTCCTCCTCTCTTAAGG - Intronic
941875962 2:170433564-170433586 ATGCATCTCCCACTTTGATAAGG - Intronic
948718763 2:239883042-239883064 CAGCACCTGCTCCTCAGATAAGG - Intergenic
1170140885 20:13124087-13124109 ATGCACATACTCTTCAGATATGG + Intronic
1171028594 20:21655296-21655318 CTTCACCTCCTCCTCTAGTAAGG + Intergenic
1172098446 20:32472138-32472160 ATGGAGCTCCGCCTCTGATGGGG - Intronic
1173015435 20:39221034-39221056 ATCCAACTCCTCCTCTCAGAAGG - Intergenic
1175736814 20:61392909-61392931 CTGCACCTCCTTCCCTGATCGGG - Intronic
1175757619 20:61539491-61539513 CCTCACCTCCTCCTCTTATAAGG + Intronic
1176205225 20:63884596-63884618 CTGCTCCTCCTTCTCTGATGGGG + Intronic
1178062853 21:28871473-28871495 ATGCACCTCCTCCAATACTAGGG + Intergenic
949691470 3:6644721-6644743 AAGCTCCTCCTCTTCTAATAAGG - Intergenic
955152854 3:56385655-56385677 AGGCACCTCCTCCACTAATGGGG + Intronic
956306965 3:67836348-67836370 ATTAAACTCCTCCTCTGCTAAGG - Intergenic
958017086 3:87950879-87950901 ATGCATTTCCTGCTTTGATAAGG - Intergenic
960648551 3:119919263-119919285 ATGAACCTCATCATCTGATAAGG - Intronic
968923880 4:3536832-3536854 ATGGACTTCCTCCTCTGCCAGGG + Intergenic
969030485 4:4209098-4209120 ATGCATCTCCTGCTTTGATGAGG - Intronic
969918165 4:10510512-10510534 ATGGACTTCCTCCTCTGCCAGGG + Intronic
971051524 4:22867698-22867720 AAGCATCACATCCTCTGATATGG - Intergenic
974645449 4:64685388-64685410 ATTCAATTCCTCCTCTCATATGG - Intergenic
976794641 4:88918908-88918930 ATCCTCCTCTTTCTCTGATAAGG + Intronic
977070046 4:92374061-92374083 ATGGACCTCCTCCTCAGCAAGGG + Intronic
982554843 4:156847304-156847326 ATGTACCTCCTGATATGATAAGG + Intronic
984657064 4:182329407-182329429 ATGCATTTCTCCCTCTGATAGGG + Intronic
986491388 5:8294637-8294659 GTGCATCTCCTGCTTTGATAAGG + Intergenic
987273203 5:16334991-16335013 ATGTACAACCTCCTCTGCTATGG - Intergenic
996354480 5:122580841-122580863 ATCCTCCTTCTTCTCTGATATGG + Intergenic
997682517 5:135766241-135766263 GTGTACATCCTCCTGTGATATGG + Intergenic
997712987 5:136021715-136021737 ATGCACCCCCTCCCCAGCTAGGG - Intergenic
998385812 5:141756558-141756580 CTTCACCTCCTCCTCTGCTCAGG + Intergenic
999683856 5:154084984-154085006 ATTGACCTCAGCCTCTGATAGGG + Intronic
1000363902 5:160473254-160473276 ATGGACTTCCTCCTCAGCTAAGG - Intergenic
1002521165 5:179793939-179793961 GTGCACCCCCTCCACTGAGATGG + Intronic
1002881233 6:1254355-1254377 CTTCACCTCCTCTTCTTATAGGG - Intergenic
1003165109 6:3670722-3670744 GTGCCCCTCCTCAGCTGATATGG + Intergenic
1004198724 6:13528917-13528939 CTGCACCAACACCTCTGATAGGG + Intergenic
1004289553 6:14353721-14353743 ATGCATTTCCTCTTCTGTTAGGG + Intergenic
1004584919 6:16989969-16989991 CTCCACCTCCTGCCCTGATATGG + Intergenic
1004824195 6:19402516-19402538 ATGAAACTCCTCCTCTGCTGAGG + Intergenic
1005321937 6:24664056-24664078 AAGCACTTCCTCCTCTGCTTAGG - Intronic
1005669616 6:28091949-28091971 ATGCATCTCCTGCTTTGACAAGG - Intergenic
1006040834 6:31253352-31253374 ATGGAACTCTTCCTCTGAGAAGG - Intergenic
1007432966 6:41786997-41787019 CTGCTCCTCCTCCTCTGACTCGG + Exonic
1007940398 6:45775293-45775315 ATGCTCAATCTCCTCTGATATGG + Intergenic
1010261678 6:73824305-73824327 ATGCTCCTCAACCTCTGAGATGG - Exonic
1013083187 6:106830886-106830908 ATGCATCTCCTGCTTTGATAAGG - Intergenic
1015695734 6:135977562-135977584 ATCCATCTCCTCCTTTGACAAGG - Intronic
1016685615 6:146879463-146879485 ATTCACCTCCCCCTGAGATAAGG + Intergenic
1016948115 6:149552622-149552644 ATGCACCTCCTCCATGGAGAGGG - Intergenic
1017108654 6:150912000-150912022 ATGCACCTCCTCCTCTGATATGG - Intronic
1018807536 6:167272974-167272996 ATGAACCTCCTCCTCTGCCAGGG - Intronic
1019117239 6:169774892-169774914 AGGCACCTGCACCTCTGACATGG + Intronic
1021423900 7:20476755-20476777 CTTAACCTCCTCTTCTGATAAGG + Intergenic
1023331717 7:39124742-39124764 ATGCACCTCTTCCACTAACAGGG - Intronic
1024819209 7:53307312-53307334 ATGCACCTCCTCCTAAGGCATGG - Intergenic
1024923049 7:54580956-54580978 ATGCAGTTTCTCTTCTGATATGG + Intergenic
1027493553 7:78860278-78860300 ATGCAGCTCCTCCTCAGCAATGG - Intronic
1027500182 7:78940519-78940541 TAGCAGCTCCTTCTCTGATATGG + Intronic
1028623546 7:92851182-92851204 ATGCACCTTCTGCTTTTATAAGG + Intergenic
1029545580 7:101208802-101208824 CTGCACCTCCTCCTCTGGGAAGG + Intronic
1033177641 7:139140262-139140284 ATGCCCATCCTCCCGTGATAGGG - Intronic
1035011370 7:155718455-155718477 CTGCTCCTTCTCCTTTGATAGGG + Intronic
1040879907 8:52193272-52193294 ATGCACCTCCTCCTCCCTTCAGG + Intronic
1044593849 8:93940023-93940045 ATGGACTTCTTCCTCTGTTAGGG - Intergenic
1046479557 8:114797845-114797867 CTGCCCCTCCTCCTCTTTTAGGG - Intergenic
1046803197 8:118451418-118451440 ATGCACCTCCTTCCACGATAAGG - Intronic
1047323516 8:123813111-123813133 ATGGAACTCTTCCTCTGAAAAGG + Exonic
1047388040 8:124427542-124427564 AGGCATCTCCTCTTCTTATAAGG + Intergenic
1049894990 9:104606-104628 GTACACCTCCTGCTCTGTTATGG + Intergenic
1051830055 9:21265933-21265955 ATGAACTTCCTCCTCTGACAGGG + Intergenic
1052308923 9:27042846-27042868 ATGCACATCTTCCTCCTATAAGG + Intronic
1052717856 9:32139485-32139507 TTGCACCACCACCTCTGAGAGGG - Intergenic
1053737396 9:41109746-41109768 GTACACCTCCTGCTCTGTTATGG + Intergenic
1053799594 9:41755857-41755879 ATGGACCTCCTCCTCTGCCAGGG + Intergenic
1054145625 9:61559141-61559163 ATGGACCTCCTCCTCTGCCAGGG - Intergenic
1054188003 9:61967917-61967939 ATGGACCTCCTCCTCTGCCAGGG + Intergenic
1054465364 9:65490245-65490267 ATGGACTTCCTCCTCTGCCAGGG - Intergenic
1054650512 9:67620664-67620686 ATGGACCTCCTCCTCTGCCAGGG - Intergenic
1054690953 9:68321573-68321595 GTACACCTCCTGCTCTGTTATGG - Intergenic
1056775290 9:89507868-89507890 ATGAACTTCCTCCTCTGCCAGGG - Intergenic
1057147787 9:92770146-92770168 ATGAACCTCCTCCTCAGCCAGGG - Intergenic
1058432925 9:104934925-104934947 ATGAACTTCCTCCTCTGCAAGGG - Intergenic
1058827381 9:108787261-108787283 ATGCACCTTCTCTTCTTATTTGG - Intergenic
1062238629 9:135524441-135524463 ATGGGCCTCGTCCTCTGACAGGG - Intronic
1203784622 EBV:120574-120596 CTGCAGCACCTCCTCTGCTATGG + Intergenic
1185510843 X:664153-664175 AAGCACCTTCTCCTCTGGCATGG + Intergenic
1191127755 X:56975604-56975626 ATGGACATCCTCCTCTGCCAGGG - Intergenic
1193283930 X:79689315-79689337 ATGGACTCCCTCCTCTGCTAGGG - Intergenic
1194204842 X:91000913-91000935 ATGGACTTCCTCCTCAGACAGGG + Intergenic
1195565510 X:106334730-106334752 AGGCAGCTGCTCATCTGATATGG - Intergenic
1198937629 X:141915536-141915558 ATGCACCTCCTCTTATGACATGG + Intergenic
1198961425 X:142187327-142187349 ATGCACCTCCTCTTATGACATGG - Intergenic
1199367832 X:147007831-147007853 CTTCACCTCCTCTTCTGAGATGG + Intergenic
1200550669 Y:4576058-4576080 ATGGACTTCCTCCTCAGACAGGG + Intergenic