ID: 1017116145 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:150978863-150978885 |
| Sequence | GCCTGATCACCCACAAGCTT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 97 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 10, 4: 86} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1017116145_1017116147 | 18 | Left | 1017116145 | 6:150978863-150978885 | CCAAAGCTTGTGGGTGATCAGGC | 0: 1 1: 0 2: 0 3: 10 4: 86 |
||
| Right | 1017116147 | 6:150978904-150978926 | TTTTCTCAATGCTCTTTACCTGG | 0: 1 1: 0 2: 2 3: 33 4: 291 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1017116145 | Original CRISPR | GCCTGATCACCCACAAGCTT TGG (reversed) | Intronic | ||