ID: 1017116147

View in Genome Browser
Species Human (GRCh38)
Location 6:150978904-150978926
Sequence TTTTCTCAATGCTCTTTACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 327
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 291}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017116142_1017116147 26 Left 1017116142 6:150978855-150978877 CCTCCTCGCCAAAGCTTGTGGGT 0: 1
1: 0
2: 0
3: 3
4: 69
Right 1017116147 6:150978904-150978926 TTTTCTCAATGCTCTTTACCTGG 0: 1
1: 0
2: 2
3: 33
4: 291
1017116143_1017116147 23 Left 1017116143 6:150978858-150978880 CCTCGCCAAAGCTTGTGGGTGAT No data
Right 1017116147 6:150978904-150978926 TTTTCTCAATGCTCTTTACCTGG 0: 1
1: 0
2: 2
3: 33
4: 291
1017116145_1017116147 18 Left 1017116145 6:150978863-150978885 CCAAAGCTTGTGGGTGATCAGGC 0: 1
1: 0
2: 0
3: 10
4: 86
Right 1017116147 6:150978904-150978926 TTTTCTCAATGCTCTTTACCTGG 0: 1
1: 0
2: 2
3: 33
4: 291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017116147 Original CRISPR TTTTCTCAATGCTCTTTACC TGG Intronic